222 results about "T vector" patented technology

The invention discloses a tumor immunization method combining with chimeric antigen T cells targeting at PD-1 (programmed cell death protein 1) and EGFR (epidermal growth factor receptor) and also discloses a plasmid vector for implementing the method. In combination with fourth-generation CAR-T (chimeric antigen receptor T) cells targeting at PD-1 and EGFR, a lentiviral vector is used as a CAR-T vector basic structure, and truncated EGFR antibody is selected as a CAR core to give tumor targeted enrichment to play, tumor-killing effect is given to play in conformity with overexpressed immune checkpoint inhibitor PD-1 monoclonal antibody; by constructing the fourth-generation CAR-T vector for co-expressing various regulatory factors such as IL21, CCR4 and Bcl2, the killing, homing and persistent proliferating abilities of CAR-T cells are improved. EP-CAR T (esophageal papilloma chimeric antigen receptor T) cells are treated by transducing patient's autologous T-lymphocytes in vitro, amplifying suitably and transducing back to the patient's body via autologous transfusion, and no reports on similar designs of CAR-T cells are provided at present.

The invention discloses a recombinant antigenic protein for diagnosing echinococcosis granulosus (having an amino acid sequence represented by SEQIDNo.1). In addition, the invention also discloses the preparation method of the recombinant antigenic protein, which comprises: amplifying an EgEPC1 gene by using RT-PCR; cloning the EgEPC1 gene in a pGEM-T vector; connecting the EgEPC1 gene with an expression vector PET28a(+) to form a recombinant plasmid PET28a-EgEPC1; transforming the recombinant plasmid PET28a-EgEPC1 to Escherichia coli BL21(DE3) and expressing the recombinant protein through IPTG induction; and identifying a purified recombinant antigen by using SDS-PAGE and Western blotting. In addition, the invention also discloses the diagnosis use of the recombinant antigenic protein. Experiments show that the recombinant antigenic protein of the invention has the advantages of high sensibility and specificity for the diagnosis of echinococcosis granulosus, and has a promising application prospect in the diagnosis of the echinococcosis granulosus.

The invention relates to a preparation method of an Escherichia coli (E.coli) biosensor and a product obtained thereby. The preparation method comprises the following steps: (1) knocking out three genes, namely copA, cueO and cusA in a wild-type E.coli MC4100 genome by a Red recombination system; (2) constructing a fusion reporter gene PcopA::gfpmut2 by adopting a cross PCR (Polymerase Chain Reaction) technology; (3) cloning the segment obtained in step (2) to a pMD18-T vector; (4) carrying out double digestion on a PcopA::gfpmut2-T vector to obtain a target strip, and then connecting the target strip to a pET28a vector; and (5) converting a fusion reporter vector obtained in the step (4) to a deltacopA-deltacueO-deltacusA tri-gene mutant strain obtained in the step (1). In the preparation method, the three genes such as the copA, the cueO and the cusA are deleted from wild-type E.coli MC4100, and then the genes are converted to the fusion reporter vector PcopA::gfpmut2-pET28a so as to finally obtain the product. The product obtained by the method has the characteristics of high specificity, high sensitivity, high speed, high efficiency, high cost performance and the like, and is simple and convenient to use, thus being applicable to real-time field monitoring of copper ions.

The invention relates to an African swine fever fluorescent PCR (polymerase chain reaction) assay reagent, an African swine fever fluorescent PCR assay kit and application thereof, which belong to the field of bioengineering. With the p72 gene as a reference, a pair of specific PCR primers and a TaqMan fluorescent probe are designed and optimized. Moreover, the primers are designed with the full length of the p72 gene to amplify the p72 gene, and the PCR product is cloned into a pGEM-T vector. Standard curves are drawn with a positive plasmid as a standard product, and the assay range is 10 to 1.0*10<7> copies. In the whole process of assaying African swine fever by an African swine fever fluorescent PCR method disclosed by the invention, only 2.5 to 3 hours are taken from DNA extraction to the appearance of an assay result, manual operation is greatly reduced, and time is greatly shortened. Furthermore, a plurality of samples can be assayed each time, and particularly assay of a large batch of samples can be realized.

The invention discloses a preparation method of developing Phaseolus vulgaris SSR primers by magnetic bead enrichment. The method comprises the following steps of: (1) digesting Phaseolus vulgaris genome DNA with Msel, and establishing a library by AFLP; (2) hybridizing the genome PCR library with a biotin-labeled repetitive sequence probe; (3) adding the hybridization mixed liquid into streptavidin-coated magnetic beads; (4) amplifying micro-satellite DNA fragments by PCR using eluent-purified micro-satellite DNA as DNA template; (5) linking the purified PCR amplification product on a T vector for cloning to obtain a DNA sequence with inserted fragments; and (6) repeating on the two sides of the core area to design primers, and screening primers to obtain effective microsatellite loci. The method is simple and feasible, increases efficiency of the primers, screens 20 pairs of effective primers from 48 pairs of primers, and provides guarantee for large-batch development of SSR primers.

The invention discloses a method for analyzing the Bacillus community structure in a white spirit fermentation system, belonging to the technical field of microbial ecology. According to the invention, the diversity of a Bacillus community structure in the white spirit fermentation system is semi-quantitatively analyzed by a nested PCR-DGGE (polymerase chain reaction-denaturing gel gradient electrophoresis) method. The method comprises the following steps of: extracting the total genome DNA (deoxyribonucleic acid) in a yeast or fermented grains sample by a bead milling method; performing two steps of amplification of the Bacillus specific segment through the nested PCR; performing DGGE electrophoretic analysis; determining the microorganism species corresponding to the DNA stripe by use of a standard strain; performing glue cutting of the unknown stripe and recycling and then performing PCR again; connecting the T vector and cloning; performing DGGE electrophoresis again; performing positive cloning sequencing and performing blast comparison in the GenBank databae to obtain the microorganism information; digitally processing DGGE map by use of quantityone software; and calculating the proportion of different Bacillus strains in the total Bacillus flora according to the brightness of the stripe. The method disclosed by the invention has the advantages of simplicity, strong specificity and good repeatability, and lays foundation for further studying the importance of Bacillus in white spirit production.

The invention discloses a method for producing recombinant dermatophagoides farinae allergen Der f1 and Der f2 fusion protein and relates to the technical field of construction of dermatophagoides farinae allergen gene by a biological technology. The method comprises the following steps of: obtaining a coding gene by extracting the total RNA of the dermatophagoides farinae and adopting PCR (Polymerase Chain Reaction) amplification, cutting glue to recover a product, named as Der fm, cloning to pMD19-T vectors, subcloning to expression vectors pET-28a(+), converting the vectors to escherichia coli, carrying out inducible expression by using IPTG (isopropyl-Beta-d-thiogalactoside). The method disclosed by the invention has the advantages that the consumed time is short, the process is simple, the cost is lower, the components such as a solvent can be thoroughly removed, the purity of the allergen can be increased fundamentally, the occurrence of side reaction in immunological therapy is avoided, the purity is high, the classification is clear, the accuracy of diagnosis can be increased, and a standard product is expected to be provided for novel immunological therapy.

The invention discloses a bacterial ghost vector PMAL-E-SN construction and application thereof in an escherichia coli comprising an E gene obtained by PCR amplification using a PhiX174 phage RFI plasmid as a template; an SN gene obtained by PCR amplification using a staphylococcus aureus standard strain ATCC25923 genome DNA as a template; an E-SN gene obtained by serial connecting the E gene and the SN gene by the Linker of the fifteen flexible amino acids; a positive plasmid pT-E-SN sequencing screened by coupling an E-SN gene PCR amplification outcome and a pMD18-T vector and the bacterial ghost vector PMAL-E-SN constructed by the recombinant plasmid pT-E-SN with right sequencing and the plasmid vector PMAL-p2X. The bacterial ghost vector PMAL-E-SN of the invention enables the E gene and the SN gene to obtain the high efficiency expression through a ''tac'' strong promoter and a malE start signal, successfully prepares the escherichia coli bacterial ghost and the degradation efficiency can reach 99.99 The invention induces a secondary killing gene SN, obtains good effect by combining the E gene and the SN gene to a high efficiency expression vector PMAL-p2X and is widely used in preparation of the escherichia coli bacterial ghost.

The invention discloses an expression process of a coat protein gene of prunus necrotic ring spot virus (PNRSV), an antiserum and a kit. The expression method comprises the following steps of: extracting a ribose nucleic acid (RNA) of the PNRSV in an affected material; adopting a transcription-polymerase chain reaction (RT-PCR) amplification process to clone the coat protein gene of the PNRSV; connecting the obtained coat protein gene to a pGEM-T vector, obtaining a pGEM-T-PNRSV recombinant vector, and using sequence analysis to determine the sequence accuracy of the coat protein gene of the PNRSV; building an eukaryotic expression vector of the coat protein gene of the PNRSV; transforming a pichia pastoris GS115 strain, and inducing a pichia pastoris expression coat protein; and using Western-blot to detect the size accuracy of an expression proteine. The invention aims to provide the process for using the pichia pastoris to express the PNRSV coat protein gene, the antiserum, and a PNRSV ELISA detection kit.

The invention discloses siRNA capable of knocking down human PD-1, a recombinant expression CAR-T vector as well as a construction method and an application thereof. The PD-1 knocking-down siRNA expression cassette and an siRNA expression product thereof can be applied to CAR-T therapy of multiple myeloma (MM) for eliminating or relieving an immune escape mechanism of tumors and can be also used for inhibiting the immune escape mechanism in the CAR-T therapy of such tumors as pancreatic cancer, brain glioma, myeloma and the like.

The present invention relates to a classical swine fever antibody PPA-ELISA detection kit and a preparation method thereof. The kit preparation comprises: adopting RT-PCR to amplify a 550 bp gene fragment of E2 gene, wherein the fragment contains 4 neutralizing antigen regions of A, B, C and D; cloning the amplified 550 bp gene fragment into a pMD18-T vector; carrying out identification, wherein the identification result is correct; further directionally cloning the fragment into a PGEX-6P-1 prokaryotic expression vector; transforming BL21 expression bacterial; carrying out IPTG induced expression to obtain recombinant protein expressed in a form of inclusion body; adopting an affinity chromatography method to separate and purify the recombinant protein; adopting immunoblotting to detect antigenicity and specificity of the purified protein; and adopting the recombinant protein as coating antigen, adopting horseradish peroxidase-labeled staphylococcal protein A (SPA) as second antibody, optimizing reaction conditions of indirect ELISA, establishing an indirect ELISA detection method for detection of classical swine fever virus antibody, and assembling the classical swine fever antibody PPA-ELISA detection kit.

The invention provides a carrier for enhancing aluminum-tolerance of a plant, and a method for establishing the same. The carrier is a plant expression vector having photoinduction promoters and phosphoenolpyruvate carboxylase (PEPC) genes. The method for establishing the carrier comprises the following steps: searching for the sequence of the full length gene of Synechococcus vulcanus PEPC in GenBank and designing a pair of primers with sequences as described in the specification; recovering and purifying PEPC full length gene segments and connecting the segments to a pUCm-T vector; establishing an entry vector pENTER*-PrbcS-PEPC; establishing a plant expression vector pH2-35S-PrbcS-PEPC. In the invention, the activity of citrate synthase of tabacoo with transgenic PEPC and CS genes is 2.4 to 2.6 times that of wild tobacco, and the activity of phosphoenolpyruvate carboxylase of such tabacco is 2.2 to 2.4 times that of wild tobacco. The special-purpose carrier provided in the invention can exert great influence on the improvement of aluminum-tolerance of a plant, and particularly, can significantly promote aluminum-tolerance of plants grown in acid red soil in southern China, thereby providing a novel approach for variety improvement of plants.

The invention relates to a chloroplast simultaneity expression seven exogenous genes vector forming method. It belongs to genetic engineering technique field. It includes the following steps: forming a chloroplast expression vector containing faeC, faeD, faeE, faeF, faeG, faeH, and faeI seven gene orders which form K88ac flagellin gene cluster; extracting coding K88ac wild bacterium C83907 plasmid; using primer 1 whose nucleotide sequence is same with SEQ ID NO: 1 and primer 2 whose same with SEQ ID NO: 2 to process PCR amplification; nucleotide sequence 3018bp is same with SEQ ID NO.5; using primer 3 whose same with SEQ ID NO:3 and primer 4 whose same with SEQ ID NO:4 to process PCR amplification; the nucleotide sequence is same with SEQ ID NO.6; connecting with pMD18-T vector; transforming to escherichia coli DH5 alpha; and gaining escherichia coli clone pTEI with faeCD sequence. The invention overcomes the key defect of polygene technique of plant genetic improvement, and offers a good method of producing effective antibody plant bacterin for baby pig.

The invention discloses preparation and application of a giant panda Ascaris schroederi Mcintosh antigen, which belong to the giant panda Ascaris schroederi Mcintosh prevention, treatment and detection field. The method comprises the following steps: a Ascaris schroederi Mcintosh antigen gene primer is designed; total RNA of ascarids undergoes reverse transcription by the RT-PCR method to synthesize cDNA, and then the cDNA is taken as a template for PCR amplification of a target product; the purified target product is connected with a pMD18-T vector and then converted into DH5 alpha competent bacteria; positive recombinant clone is selected through flat screening and culture of the bacteria, and the antigen genes have a Bs-Ag1gene, a Bs-Ag2 gene and a Bs-Ag3 gene after culture and sequencing; and then recombinant plasmids which are accurately sequenced are converted into Escherichia coli BL21 competent cells for mass expression of proteins after construction of the recombinant plasmids, induction expression and purification of the recombinant proteins. After detection and immunologic tests of the product and ELISA detection and analysis of a test animal antibody IgG, the Bs-Ag1gene, the Bs-Ag2 gene and the Bs-Ag3 gene of the giant panda Ascaris schroederi Mcintosh antigen can be taken as candidate genes for preparing genetic engineering vaccines through the sascarids; and the recombinant proteins Bs-Ag1, Bs-Ag2 and Bs-Ag3 have good reactionogenicity and can be used for detecting infection of giant panda Ascaris by the ELISA method.

The invention discloses a preparation method of an anti-canine parvovirus protein VP2 specific IgY, which comprises the following steps: (1) designing a pair of primers according to CPV-VP2 gene sequence, carrying out PCR (polymerase chain reaction) amplification on the CPV-VP2 gene, connecting to a pMD18-T vector, transforming DH5alpha competent cell, carrying out blue-white screening, extracting the plasmid, carrying out digest enzyme digestion ion analysis, carrying out positive plasmid sequencing, and carrying out comparative analysis on the sequencing result; (2) expression and purification of VP2 protein in Escherichia coli: carrying out BamH I and Xho I double-enzyme digestion on the pMD18-T-VP2 and pET-32a,connecting to the target segment, constructing the pET-32a-VP2 expression vector, transforming Bal21(DE3)pLysS competent bacteria, carrying out enzyme digestion and PCR identification, optimizing the IPTG (isopropyl-beta-D-thiogalactopyranoside) induction concentration and time, carrying out mass induction expression, and purifying the recombinant protein by using a Ni<+> affinity column; and (3) preparation of anti-VP2-IgY antibody: immunizing a laying hen by using the purified VP2 protein, extracting the specific IgY antibody by using PEG 6000, and carrying out SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) analysis. The anti-VP2-IgY antibody extracted by the method can be well combined with the VP2 protein to carry out non-cross reaction on the degradation segment.

The invention discloses a preparation method of an antibacterial peptide gene engineering strain. The method comprises the following steps of: firstly, designing a new antibacterial peptide gene according to the characteristic of an antibacterial peptide Cecropin A amino acid sequence, adding a histidine marked sequence at the 5'end of the sequence, and respectively adding Xho I and Not I restriction enzyme cutting site sequences at the two ends to synthesize a sequence of the antibacterial peptide gene; secondly, cloning the obtained product to a T vector; thirdly, constructing a target gene into a yeast expression vector pPIC9k to construct a recombination vector pPIC-CEC containing the target gene; and fourthly, transforming the recombination vector pPIC-CEC into pichiapastoris for expressing to form a antibacterial peptide gene transformation pichiapastoris engineering strain GS115 (pPIC-CEC). The strain can express and generate gene engineering antibacterial peptide Cecropin A, has low cost, can ferment in large scale, and is convenient to produce and easy to realize industrialization. The invention has the advantages of simple operation method, easy observation and good repeatability. The expressed product can be applied to biological control of fruits after picking and can bring certain economic benefit.

The invention discloses a recombinant bacillus subtilis EV71-VP1 expression vector, the vector is an escherichia coli-bacillus subtilis shuttle expression vector, and a coding gene of capsid protein VP1 of EV71 virus is loaded on the vector. The construction method is as follows: (1) amplifying CotB gene regulatory sequence and coding sequence of bacillus subtilis, connecting to a pMD18T vector, and obtaining plasmid pDG1662-CotB; and (2) amplifying enterovirus 71 type capsid protein VP1 antigen sequence, connecting to the plasmid pDG1662-CotB, and obtaining plasmid pDG1662-CotB-VP1 which is the recombinant bacillus subtilis EV71-VP1 expression vector. After introducing the recombinant vector into host cells for culturing, oral vaccines for preventing or treating diseases caused by EV71 can be further prepared.

The invention relates to a non-false-positive T vector for cloning PCR fragments, and preparation thereof. The T vector is a linearization plasmid vector, of which two 3' ends both have a prominent dT, wherein sites of the T vector in which the PCR fragments of a dA prominent at the 3' ends, namely two tails ends of a linearization T vector, are positioned between an initiation codon of positive-clone selective marker gene and an upstream ribosome bind site. When the T vector designed and constructed according to the invention is used for cloning the PCR fragments, false-positive cloning cannot be produced because of the frame shift of the positive-clone selective marker gene, which is caused by the self connection of the T vector. The T vector overcomes the technical-mechanism disadvantage that the prior T vector produces false-positive clones during application because of the self connection of the vector. Therefore, from a technical mechanism (namely excluding the interference of other experimental factors), the T vector designed by the invention is void of the rate of false-positive cloning when the T vector is applied to T-A cloning.

The invention provides a method for obtaining an FSHR (follicle-stimulating hormone receptor) full-length coding region sequence with multiple splice forms. The method comprises the steps: extracting total RNA of a sheep granular cell, and reversely transcribing into cDNA; according to initiation codon upstream and termination codon downstream of a cDNA sequence of a sheep FSHR gene, designing two pairs of primers, wherein an upstream primer F1 is CAAAAGGGCTCAGTGTGGAG, an upstream primer F2 is CGTCTGCAGAAGCAGAAGCA, a downstream primer R1 is CTTATGGATGTGCCAGGGAG, and a downstream primer R2 is AGTGCTCTGTCAGCTCTTGC; taking the obtained cDNA as a template, carrying out PCR amplification of the FSHR gene, and extracting the PCR product by a Tiangen gel extraction kit; and adding an A tail into the PCR product, and cloning, sequencing and verifying an T vector. The obtained FSHR full-length coding region sequence with the multiple splice forms is characterized by comprising the oFSHR695, oFSHR694, oFSHR648, oFSHR633 and oFSHR595.

The invention discloses a group-I type-4 aviadenovirus DNA (Deoxyribonucleic Acid) vaccine. The antigen of the group-I type-4 aviadenovirus DNA vaccine contains a group-I type-4 aviadenovirus penton gene. The invention also discloses a preparation method and application of the group-I type-4 aviadenovirus DNA vaccine. The preparation method comprises the following steps of (1) designing a group-I type-4 aviadenovirus penton gene primer with EcoR I and Sal I restriction enzyme cutting sites, and amplifying the target gene fragment by using the group-I type-4 aviadenovirus DNA as a template; (2) connecting the penton gene fragment onto a pMD-18T vector; (3) connecting the penton gene to an eukaryotic expression vector pCI; (4) transfecting pCI-penton into an LMH cell; and (5) performing amplification and extracting and purifying pCI-penton. The group-I type-4 aviadenovirus DNA vaccine has the advantages that the preparation is simple; the use is convenient; the cost is low; the humoral immunity and the cellular immunity can be excited at the same time; the comprehensive protection is effectively provided for SPF chickens; and the toxicity enhancing risk does not exist.

The invention discloses an Escherichia coli for producing isoeugenol monooxygenase and a construction method and an application of Escherichia coli. The Escherichia coli is named as BL21 (DE3) IEM-PP, and the preservation number is CGMCC No. 8918. The construction method comprises the steps of amplifying whole genome DNA of soil as a template by a PCR (polymerase chain reaction) technology under the action of PCR primers to obtain fragments of which the lengths are 1438bp, carrying out gel extraction and recovery, purifying and linking with a T-vector pET21 (a) to obtain the recombinant strain BL21 (DE3) IEM-PP cloning vector recombinant plasmid PET21 (a)-IEM. The Escherichia coli can be applied in producing vanillin by the biotransformation of isoeugenol via the recombinant strain.

The invention discloses an agrobacterium-mediated spirodela polyrhiza stable transformation system establishment method, which comprises the following steps: A, inducing calli of spirodela polyrhiza; B, connecting a target gene with a T vector; C, connecting the target gene with a plant expression vector; D, transforming the plant expression vector in agrobacterium tumefaciens LBA4404; E, preparing an infective bacteria solution; F, co-culturing the calli and the agrobacterium tumefaciens; G, performing regeneration and selective culturing: determining that the target gene is successfully integrated into a genome of the spirodela polyrhiza if a GUS (glucuronidase) staining result of thalli is blue, and determining that a part which is stained to be blue by thallus tissues is a part expressed by the target gene. The target gene is inserted into the plant expression vector and then transferred into the agrobacterium tumefaciens LBA4404 for callus infection, and the concentration of antibiotics is finally controlled to screen a positive plant to obtain transgenetic spirodela polyrhiza, and an established transformation system can still ensure continuous and stable inheritance after asexual reproduction of the spirodela polyrhiza, and has bio-safety and development and application value.

The invention belongs to the technology field of the gene engineering, in particular relates to a specificity molecule marker which can distinguish laminaria female and male gametophyte. The specificity molecule marker is obtained through the following method: two pairs of primers of SEQ ID No1and SEQ ID No2 are designed according to 5'end flanking sequence of the laminaria female and female gametophyte gene groups, polymerase chain reaction amplification is performed to the deoxyribonucleic acid of the laminaria female and female gametophyte gene groups, and the deoxyribonucleic acid of specificity amplification fragment are reclaimed; large intestine rod competent strain JM109 is cloned through pMD19-T vector to obtain a laminaria female gametophyte specificity molecule marker Rf-763 and a laminaria male gametophyte specificity molecule marker Rm-239, and the sequences thereof are SEQ ID No3 and SEQ ID No4. The genders of the laminaria gametophyte, parthenogenesis laminaria sporophyte parental source and the genders of the offspring thereof can identified through utilizing the specificity molecule marker, and the laminaria gender differentiation in basis of the cell and molecule level can be studied.

The invention relates to a T vector for screening protein mutants with high water solubility / foldability and a construction method and application thereof in the field of directed evolution of protein. The T vector has the advantages of high throughput, high sensitivity and convenient screening. Six histidine (His) tags, multiple cloning sites (MCS) and the cobA gene sequence of coding red fluorescent protein UPMT are introduced into a departure vector pMAL-c2x so as to form the T vector. The T vector which is constructed by the method and used for screening the solubility expression of the protein is provided with a strong Ptac promotor, can directly clone, express and purify a PCR product, and particularly can conveniently screen the protein mutants with high water solubility / super foldability.

The invention discloses a preparation method and application of fusion protein with broad spectrum adsorption capacity to antibodies. The method includes the steps: obtaining a protein A and a protein G immune globulin binding zone gene by means of T vector connection and double digestion by the genetic engineering means and via PCR (polymerase chain reaction) amplification; then connecting onto an expression vector pET-23a to form a recombinant plasmid, converting E.coli BL21(DE3), and obtaining a great number of thalli containing the fusion protein AG after inducible expression; and finally, performing ultrasonication, high-temperature heating, precipitation of DNA (deoxyribonucleic acid) and purification of weak anion exchange chromatography and affinity chromatography so that the fusion protein AG is obtained. The fusion protein has dual advantages of the protein A and the protein B and is wider in spectrum combination and low in nonspecific adsorption of non-immune globulin substances of albumin in serum and the like. The fusion protein serving as a ligand is connected to a solid-phase vector matrix to be prepared into adsorbent so that the shortcoming of poor IgG3 binding force of protein A adsorbent is overcome, and can be applied to the fields of antibody purification, blood purification and the like.

The invention discloses a brassica napus BnPABP8 promoter and a preparation method and use thereof. The preparation method comprises the following: A, a step of primer design, which is to design specific walking primers according to known sequences; B, a step of brassica napus promoter preparation, which is to extract brassica napus DNA by using a sodium dodecyl sulfonate (SDS) lysis method, perform genome walking according to genome walking kits, digest 5 micro liters of DNA by using DraI enzyme, detect the purity of the DNA, perform enzyme digestion of the DNA by using the incision enzymes provided by four kits, and purify the product of the enzyme digestion; C, a step of purification, which is to add ethanol into enzyme digestion solution, precipitate, centrifuge, dry in the air, dissolve in sterile water and add specific connectors after purification is accomplished, wherein GSP1 and AP1 are used as primers in primary polymerase chain reaction (PCR) reaction; and D, a step, which is to perform amplification by using the diluted solution of the product of the primary PCR reaction as a template and GSP2 and AP2 as primers in a secondary PCR reaction, recover purified product of the secondary PCR product, connect with a T vector, and obtain the PBnPABP8. The invention also discloses the use of the PBnPABP8 in roots, stems, leaves, buds and anthers of plants. When the promoter is used, the safety of the edible brassica napus oil can be improved, and the disease resistance, stress resistance and lodging resistance in crops can be improved by transgenosis.

The invention discloses a preparation method of an acidithiobacillus ferrooxidian genetic engineering strain with quick growth speed and strong uranium and heat resistance capacities as well as the application thereof, wherein the strain is Acidithiobacillus ferrooxidans QEY-6(pJRD215-PT-rcs), CCTCCM 209156; and the preparation method comprises the following steps: firstly, augmenting a T5 promoter and a T0 terminator of pQE30, and establishing a shuttle expression vector pJRD215-PT together with pJRD 215; secondly, augmenting and cloning a micrococcus luteus rpf gene, a caulobacter crescentuscc3302 gene and a sulfolobus shibatae ss10b gene to a T vector; thirdly, establishing a recombined shuttle expression vector pJRD215-PT-rcs; and fourthly, establishing the acidithiobacillus ferrooxidian genetic engineering strain which fusedly expresses rpf, cc3302 and ssh10b genes. The invention has simple operation and good repeatability, and can shorten the uranium leaching period, improve theleaching rate and reduce the acid-consuming rate.

The present invention belongs to the field of enzyme genetic engineering technology, and is especially hydrolyzed soybean isoflavone glycosidase engineering strain and its construction method and use in producing hydrolyzed soybean isoflavone glycoside. The present invention obtains high activity hydrolyzed soybean isoflavone glycosidase engineering strain through culturing lactic acid bacteria containing beta-glucosidase, extracting glucosidase genome DNA, PCR proliferation, sequencing, subcloning the gene to T vector, final cloning to expression vector and expressing in colibacillus. The obtained engineering bacteria have high enzyme activity, low cost, obvious hydrolysis effect on soybean isoflavone glycoside and high safety, are used in functional food and possess wide application foreground.

The invention discloses a recombinant large-tooth flounder interleukin-6 protein and a preparation method thereof. The preparation method comprises the following steps: according to a DNA sequence of the large-tooth flounder interleukin-6 protein of paralichthys olivaceus, designing a primer and extracting the total RNA of the kidney fresh by a TRIzol Reagent method, carrying out RT-PCR augmentation, connecting a PCR product and a Pmd19T vector to form a recombinant plasmid, connecting with an expression vector Pet-32a(+) by double digestion, obtaining the recombinant plasmid and transforming the recombinant plasmid into escherichia coli BL21 (DE3); and realizing the soluble expression of the recombinant protein. As the expression process does not generate an inclusion body, the fusion protein for expressing the plasmid has histidine tags, thus being convenient to identification and purification of samples, avoiding the denaturation and renaturation of the samples, having simple operation, reducing the manufacturing cost, and more importantly, having no damage to a protein structure; and the invention has good purity of recombinant protein, high yield and difficult degradation, is applicable to industrial production and lays the foundation of studying the large-tooth flounder interleukin-6 protein of the paralichthys olivaceus.

The invention discloses a method for determining a 3' end flanking unknown sequence based on the known DNA sequence by utilizing technologies such as restriction endonuclease cutting, pUCm-T vector, nested polymerase chain reaction (PCR) amplification and the like. In the method, genome DNA is cut by restriction endonuclease, the purified enzyme-cutting product is complemented by Taq enzyme or Ex Taq enzyme, is subjected to 3' end A addition reaction, and is connected with the pUCm-T vector; a segment of sequence on the downstream of a T / A cloning site on the T vector is selected as a 3' end primer through primer design software; and two sequences of the known DNA close to the unknown sequence end are selected as 5' end primers. A pUCm-T vector junctional complex is taken as a template, the nested PCR amplification is carried out through the designed primers, and the amplified segments are subjected to cloning and sequencing. The method has the characteristics of simple operation, wide application range, a few operational constraints, simple and quick result verification, unlimited length of unknown sequence, low cost and the like.