Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

113 results about "Granular cell" patented technology

Granule cell 1. Any of the small neurons that pack the granular cell layer of the cerebellar cortex, immediately below the Purkinje cell layer. Granule cells receive inputs (mossy fibers) from the spinal cord and brainstem (except the inferior olive). 2. Any of the neurons of the cerebral cortex that are not pyramidal cells.

Microanalysis of cellular function

ActiveUS20130261021A1Rapid and efficient testingRapid and efficient timingDielectrophoresisLibrary screeningAntibody-Secreting CellsGranular cell
An inverted microwell (102) provides rapid and efficient microanalysis system (100) and method for screening of biological particles (128), particularly functional analysis of cells on a single cell basis. The use of an inverted open microwell system (102) permits identification of particles, cells, and biomolecules that may be combined to produce a desired functional effect also functional screening of secreted antibody therapeutic activity as well as the potential to recover cells and fluid, and optionally expand cells, such as antibody secreting cells, within the same microwell.
Owner:CELLPLY SRL

In-vitro recombined human skin epidermis model and preparation method and application thereof

The invention discloses an in-vitro recombined human skin epidermis model.A layer of hemidesmosome protein is arranged on the lower surface of a basal cell layer, the upper surface of the basal cell layer is covered with 6-8 spinous cell layers containing short protruding spinous cells, the upper surface of the spinous cell layers is covered with 3-4 granular cell layers containing transparent granular cells, the upper surface of the granular cell layers is covered with a keratinocyte layer, all the cell layers are obviously separated, and the overall barrier function of a lipid composition is approximate to that of human skin.A preparation method comprises the steps of preparation of matrigel particles, screening and amplification of epidermal stem cells, preparation of the basal cell layer, preparation of the spinous cell layers, preparation of the granular cell layers, and maturation and keratinization of the in-vitro recombined epidermis model.The model is applied to evaluation of cosmetics with the human skin barrier repair effect, screening of plant extract with the human skin barrier repair effect, evaluation and detection of irritation of medical apparatus materials on the human skin and detection of irritation of chemicals on the skin.
Owner:GUANGDONG BOXI BIO TECH CO LTD

Method for obtaining FSHR full-length coding region sequence with multiple splice forms

The invention provides a method for obtaining an FSHR (follicle-stimulating hormone receptor) full-length coding region sequence with multiple splice forms. The method comprises the steps: extracting total RNA of a sheep granular cell, and reversely transcribing into cDNA; according to initiation codon upstream and termination codon downstream of a cDNA sequence of a sheep FSHR gene, designing two pairs of primers, wherein an upstream primer F1 is CAAAAGGGCTCAGTGTGGAG, an upstream primer F2 is CGTCTGCAGAAGCAGAAGCA, a downstream primer R1 is CTTATGGATGTGCCAGGGAG, and a downstream primer R2 is AGTGCTCTGTCAGCTCTTGC; taking the obtained cDNA as a template, carrying out PCR amplification of the FSHR gene, and extracting the PCR product by a Tiangen gel extraction kit; and adding an A tail into the PCR product, and cloning, sequencing and verifying an T vector. The obtained FSHR full-length coding region sequence with the multiple splice forms is characterized by comprising the oFSHR695, oFSHR694, oFSHR648, oFSHR633 and oFSHR595.
Owner:新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心

Application of RBP1 gene in sow ovarian granular cells

The invention discloses application of a RBP1 gene in sow ovarian granular cells. RBP1 is taken as a research object, and a molecular and cell biological method is adopted to study the application ofthe RBP1 in sow ovarian granular cells. The molecular and cell biological method includes the following steps that through ChIP-Seq, it is found that the enrichment degree of H3K4me3 is different in RBP1 gene promoter regions in follicles different in size; through qRT-PCR, it is found that the expression quantity of the RBP1 gene in follicles different in size is different significantly. By promoting or inhibiting the enrichment degree of H3K4me3 in the sow ovarian granular cells, it is found that promotion of the enrichment degree of H3K4me3 can promote transcription of the RBP1 gene, and inhibition of the enrichment degree of H3K4me3 can inhibit transcription of the RBP1 gene; through RBP1 over-expression or interference with RBP1, it is found that RBP1 can promote proliferation of thesow ovarian granular cells and inhibit apoptosis.
Owner:SOUTH CHINA AGRI UNIV

Separation culture method of laying duck small yellow follicle granular cells

The invention discloses a separation culture method of laying duck small yellow follicle granular cells. The separation culture method includes following steps: selecting a laying duck, killing the laying duck by bloodletting a jugular vein, respectively using bromogeramine diluent and alcohol to disinfect the body of the laying duck, and separating follicles of 3-8 mm in an ovary; stripping outer-layer blood vessels and connective tissue of the follicles, fixing the follicles, discharging yolk, stripping granular cell layers, and cleaning before centrifuging to abandon supernate, adding an enzymolysis solution for digestion, sieving, cleaning with an M199 culture medium, centrifuging to abandon supernate; adding red blood cell lysis liquid, and centrifuging to abandon supernate; adding an M199 culture medium containing fetal calf serum, suspending granular cells, adjusting density of suspension cells, and inoculating for culture to obtain the laying duck small yellow follicle granular cells. The separation culture method is suitable for both separation of granular cells in big yellow follicles of ducks and separation of small yellow follicle granule cells; the granular cells are high in purity and activity and stable in cell function; the separation culture method has the advantages of simple operation, easiness in repeating and stable result.
Owner:ANIMAL SCI RES INST GUANGDONG ACADEMY OF AGRI SCI

Separation, primary culture and subculture method for granular cells in follicles in porcine ovary GV period

The invention discloses a separation, primary culture and subculture method for granulosa cells in follicles in a pig ovary GV period. The method comprises the following steps: collecting a cyst-free healthy pig ovary, and cleaning the ovary; separating granular cells; carrying out primary culture on the granular cells for 48 hours; changing liquid in a culture bottle for primary culture; after changing the liquid, continuously culturing the cells for 36 hours, and cleaning, digesting and terminating the cultured cells; and finally, sub-packaging and subculturing the cells for 48 hours. The invention provides a pollution-free ovary collection method, optimizes a granulosa cell acquisition and culture method, and further provides a primary granulosa cell subculture method. Granular cells obtained by the method are almost free of pollution, high in cell uniformity, high in consistency in the growth and development period, high in cell survival rate, high in success rate of making oxidative stress models and the like, and high in result consistency, practicability, stability and feasibility. In addition, the number of obtained cells is large, many subsequent experiments can be carried out, the number of times of going to a slaughter house is reduced, and the efficiency is high.
Owner:DALI UNIV

Application of nicotinamide mononucleotide in preparation of medicine for preventing, improving and/or treating polycystic ovarian syndrome

The invention relates to the field of biological medicines, in particular to an application of nicotinamide mononucleotide in preparation of a medicine for preventing, improving and / or treating the polycystic ovarian syndrome (PCOS). A PCOS rat model is constructed by combining letrozole with high-fat feed, the protective effect of the nicotinamide mononucleotide on the PCOS is studied, and experimental results show that nicotinamide mononucleotide intervention can obviously improve the follicular development condition of PCOS rats, increase the number of corpus luteum, thicken granular cell layers, restore the oestrus cycle of the rats, reduce body weight and fasting blood sugar, reduce serum androgen, luteinizing hormone, insulin and insulin resistance index level, increase secretion oflactic acid and ATP, and improve ovarian energy metabolism.
Owner:NANHUA UNIV

Method for evaluating sperm intracorporal conception rate of breeding bull according to extracorporal fertilization rate of breeding bull

ActiveCN103392670AEstimation of Actual FertilityKeep abreast of fertilityAnimal husbandryGranular cellBovine oocyte
The invention discloses a method for evaluating the sperm intracorporal conception rate of a breeding bull according to the extracorporal fertilization rate of the breeding bull, and belongs to the technical field of animal reproduction. The method includes the steps that COCs is washed by bull oocyte egg picking liquid and bull oocyte mature liquid respectively, placed in the bull oocyte mature liquid for culture, and placed in bull sperm drips capacitated by BO-AB liquid for fertilization; then granular cells are taken off by IVC SOF liquid, then eggs with the granular cells which are taken off are placed in SOF liquid for culture, and the extracorporal fertilization cleavage rate is measured; artificial insemination is conducted, the conception rate of the breeding bull is measured, and the breeding bull is evaluated according to the relevance of the cleavage rate and the conception rate. The method has the advantages that by the utilization of sperm extracorporal fertilization rate of the breeding bull, the practical conception capacity of the breeding bull can be rapidly estimated, the breeding capacity of the breeding bull can be known in time, the problem that a large amount of time, labor and money need to be wasted for detecting the breeding capacity of a breeding bull individual through manual insemination is solved, and resources are saved.
Owner:内蒙古赛科星繁育生物技术(集团)股份有限公司

Culture method for in-vitro human oocyte preantral follicles

InactiveCN103146643APromote maturityGuaranteed quality of lifeGerm cellsGranular cellGranulosa cell proliferation
The invention provides a culture method for in-vitro human oocyte preantral follicles. The culture method is characterized by comprising the following specific steps of: 1) unfreezing the in-vitro human oocytes placed in frozen protecting solution containing cane sugar and propylene glycol and subjected to liquid nitrogen low-temperature storage, and then reviving and culturing; and 2) separating and extracting the in-vitro human oocytes obtained by reviving and culturing, then placing the in-vitro human oocytes in nutrient solution containing follicle-stimulating hormone (FSH), and performing preantral culture, wherein the culture for in-vitro human oocyte preantral follicles needs the support of FSH, and FSH can be used for promoting the growth of the follicles, increasing the survival time of the follicles, promoting the proliferation of granular cells, and promoting the maturation of the oocytes, as well as is an important factor for regulating and controlling the growth and development of the follicles; and trichostatin A can be used for effectively inhibiting the proliferation of tumour cells, regulating and controlling the progress of a cell cycle and then inducing the apoptosis of tumour cells, thus ensuring the survival quality of the cells. The method has important significance on researches in the aspect of test-tube babies.
Owner:孔凡锋
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products