1ncRNA SFR1 as well as application thereof and product and method for regulating and controlling follicular development
A technology of follicle development and products, which is applied in the field of products regulating follicle development, and can solve problems such as low fecundity and impact
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0077] Example 1 Location of lncRNA SFR1
[0078] During the screening of differentially expressed genes with different litter sizes, the inventors detected a new differentially expressed lncRNA (MSTRG.28645), and named it SFR1 (Sheep Fedunty Related LncRNA1, SFR1).
[0079] SFR1 was used in cpc( http: / / nar.oxfordjournals.org / content / 35 / suppl_2 / W345.full ) software and cnci ( https: / / github.com / www-bioinfo-org / CNCI ) lncRNA predicted by the software for the first time. After working with Ovis aries4.0( https: / / www.ncbi.nlm.nih.gov / genome / 83?hl=en genome_assembly_id=259810 ) comparison of the reference genome, it was found that it is located on chromosome 6 of sheep, and its position on the comparison is 66449727-66452013.
[0080] In order to determine whether the newly predicted lncRNA SFR1 is expressed in sheep granulosa cells, qRT-PCR primers for SFR1 (Forward: AGTCATT CCAAACTTCATCCTCC; Reverse: GGGACACTCTTCCGACTATTACAA) were designed based on the sequence inform...
Embodiment 2
[0081] Example 2 Overexpression of lncRNA SFR1
[0082] Firstly, the full-length 2,791bp cDNA sequence of sheep lncRNA SFR1 was cloned, and then the eukaryotic expression vector of sheep SFR1: pIRES2-ZsGreen1-SFR1 was constructed, and its function was verified by transient transfection in sheep ovary granulosa cells. The relative expression of SFR1 was 150.88±13.13%, as figure 2 shown. Among them, "control" represents the untreated control group; "SFR1" represents the SFR1 expression-treated or interfered-treated group. "OE" represents the SFR1 overexpression treatment group; "siRNA-1" represents the SFR1 siRNA-1 treatment group; "siRNA-2" represents the SFR1 siRNA-2 treatment group; "siRNA-3" represents the SFR1 siRNA-3 treatment group. Data are expressed as mean ± SEM, and statistical analysis was performed using t-test. * means significant difference, p<0.05.
Embodiment 3
[0083] Example 3 siRNA interference of lncRNA SFR1
[0084] In order to achieve a better siRNA interference effect, three pairs of interference fragments were first designed for sheep SFR1 (siRNA1 (1987): CCGAAUUCCUGACAUAUAUTT AUAUAU GUCAGGAAUUCGGTT; siRNA2 (2498): CCGCAAUAUGUAAGACAAA TT UUUGUCUUACAUAUUGCGGTT; siRNA3 (2279): GGACACCUACAGAGACUUGAATGAGU) figure 2 As shown, the expression levels of SFR1 relative to the blank group were 94.94 ± 12.20%, 89.48 ± 4.19% and 33.32 ± 1.29% respectively after the interference of 3 pairs of interference fragments. Therefore, the third pair of interference fragments (SEQ ID NO.2 and SEQ ID NO.2 and SEQ ID NO. .3) Perform subsequent cell transfection experiments.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap