Product
Patsnap Eureka
For R&D, Patsnap Eureka makes reading and utilizing patents & technical documents easy.
Patsnap Eureka AIR
Designed for self-driven R&D workflows. Generate viable solutions, solve complex R&D challenges, empower your innovation with AI.
Patsnap Eureka Materials
Designed for material experts only. Revolutionize your material R&D, from search, analyze, to developing new materials.
Feature
TechResearch
Generate reliable direction feasibility study reports for your R&D in just a few steps.
TechSeek
Discover and master advanced knowledge NOW. Basics, ideas, possibilities, all at once.
TechMind
As an expert in R&D Theories, TechMind can generates customized viable solutions instantly.
TechRisk
Analyze your overall solution with one click, know your potential R&D risks in advance.
TechMonitor
Get weekly tech updates, stay abreast of the latest tech innovations and key insights.
Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
47 results about "Gel extraction" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
In molecular biology, gel extraction or gel isolation is a technique used to isolate a desired fragment of intact DNA from an agarose gel following agarose gel electrophoresis. After extraction, fragments of interest can be mixed, precipitated, and enzymatically ligated together in several simple steps. This process, usually performed on plasmids, is the basis for rudimentary genetic engineering.
Method for eliminating mecA plasmids based on CRISPR/Cas9 technology
InactiveCN106167808AAvoid conversionEasy to operateNucleic acid vectorVector-based foreign material introductionBiotechnologyMethicillin resistance gene
The invention discloses a method for eliminating mecA plasmids based on CRISPR / Cas9 technology. The method comprises: selecting an MRSA strain to perform PCR amplification to a DNA sequence of a C terminal of mecA gene coding transpeptidase; carrying out gel extraction for mecA genes; connecting the mecA genes with a T-pMD19 (simple) carrier and preparing DH5[alpha] competent cells; electro-transforming the DH5[alpha] competent cells through the obtained T-pMD19-mecA plasmids; extracting the T-pMD19-mecA plasmids and performing sequencing and verification; performing double digestion treatment for the T-pMD19-mecA plasmids and performing gel extraction to the mecA genes; connecting pET-21a (+) plasmids with the mecA genes; designing and synthesizing oligos; constructing pCas9 :: mecA plasmids; electro-transforming the obtained pET-21a (+)-mecA plasmids into an escherichia coli expression strain BL21 (D3); and electro-transforming the pCas9 :: mecA plasmids and the pCas9 plasmids into BL21 (D3)+pET-21a(+)-mecA competent bacteria and BL21 (D3)+pET-21a(+) competent bacteria. The method is simple to operate and good in specificity, and can effectively block spread of mecA to eliminating the mecA strain.
Owner:ZHENGZHOU UNIV
Indirect ELISA detection kit of sheep echinococciosis Eg95 protein antibody
InactiveCN107831319AStrong specificityIncreased sensitivityBiological testingPichia pastorisPositive control
The invention discloses an indirect ELISA detection kit of sheep echinococciosis Eg95 protein antibody. The invention is characterized in that the kit comprises an echinococcus granulosus recombinantantigen Eg95 protein precoated ELISA plate, a serum diluent, an enzyme-labeled conjugate diluent, a positive control solution, a negative control solution, an enzyme-labeled conjugate, a washing solution, a substrate developing solution and a stopping solution. During the preparation process of the echinococcus granulosus recombinant antigen, a His tag sequence and a Myc tag sequence are respectively connected to the front and back of the Eg95 gene; then, EcoR I and Xho I are adopted for simultaneous digestion of a PCR product and an eukaryotic expression vector pPIC9K, the target fragment andthe vector are connected after gel extraction, recombinant plasmid pPIC9K-(His-Eg95-Myc) is constructed, the recombinant plasmid is transformed into pichia pastoris GS115 strain, and the recombinantantigen Eg95 is expressed by the induction of methanol and purified by the use of Ni-NTA. The sheep echinococciosis antibody detection kit obtained by the adoption of the dual-tag sequence and eukaryotic expression vector system has strong specificity, high sensitivity and good repeatability, and is easy to operate.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Method for extracting total DNA (deoxyribonucleic acid) of mulberry rhizosphere soil microorganisms by adopting plurality of measures
InactiveCN102643794AGood cracking effectHigh yieldMicrobiological testing/measurementDNA preparationFreeze and thawCommunity structure
The invention discloses a method for extracting total DNA (deoxyribonucleic acid) of mulberry rhizosphere soil microorganisms by adopting a plurality of measures, which can achieve a good cell lysis effect by utilizing PVP (polyvinyl pyrrolidone) prewashing to remove humic acid, the synergy of CTAB (cetyltrimethyl ammonium bromide), lysozyme, protease and SDS (sodium dodecyl sulfate) to lyse cells and repetitively freezing and thawing the cells at the same time and utilizes PEG8000 to precipitate DNA, so that the purity of the obtained DNA is high. The adopted method is simple and convenient, and the DNA can be used in subsequent PCR (Polymerase Chain Reaction) analysis and DGGE (denaturing gradient gel electrophoresis) analysis without needing to be purified. The extracted DNA is so pure as to meet the requirement of direct subsequent molecular biology research, an extracted DNA fragment can be used in the amplification and DGGE map analysis of 16SrDNA, moreover, the specific band gel extraction and base sequencing of a DGGE band can be carried out, comparison with the sequence existing in an RDP (ribosomal database project) database can be carried out, or a new sequence probe can be established to identify unknown bacteria, so that the composition of a microbial community structure can be determined, and thereby laying a foundation for the future research of the community structure diversity and the ecological functions of the mulberry rhizosphere soil microorganisms.
Owner:INST OF ECONOMIC CROP HUBEI ACADEMY OF AGRI SCI
Quantitative detection method of antibiotics resistance gene in soil
The invention discloses a quantitative detection method of antibiotics resistance gene in soil. The method comprises the following steps: (1) selecting pigs which usually eat antibiotics, taking the pig manure DNA as the template, amplifying the target resistance gene sections by PCR; (2) carrying out gel extraction and purifying the amplified target resistance gene, inoculating the resistance gene onto a T carrier, converting to competence colibacillus cells, coating the cells on a LB plate, selecting the positive clones; (3) detecting the quality of amplified culture bacterium liquid through an agarose gel electrophoresis (AGE) method, extracting plasmids from bacterium liquid in which target resistance gene has been successfully cloned, measuring the plasmid concentration, calculating the copy number of the resistance genes carried by the plasmids, diluting the bacterium liquid as the resistance gene standard for later use by taking 10 times as the dilution gradient; (4) extracting soil genome DNA, simultaneously carrying out quantitative PCR amplification on the soil sample DNA and the resistance gene standard, and finally figuring out the copy number of the resistance gene in the soil sample.
Owner:ZHEJIANG UNIV
Gel extraction device
ActiveUS20060099114A1Quick and easy single handedSludge treatmentMaterial analysis by electric/magnetic meansGel extractionAir cavity
Owner:LABGADGET LLC
Method for obtaining FSHR full-length coding region sequence with multiple splice forms
The invention provides a method for obtaining an FSHR (follicle-stimulating hormone receptor) full-length coding region sequence with multiple splice forms. The method comprises the steps: extracting total RNA of a sheep granular cell, and reversely transcribing into cDNA; according to initiation codon upstream and termination codon downstream of a cDNA sequence of a sheep FSHR gene, designing two pairs of primers, wherein an upstream primer F1 is CAAAAGGGCTCAGTGTGGAG, an upstream primer F2 is CGTCTGCAGAAGCAGAAGCA, a downstream primer R1 is CTTATGGATGTGCCAGGGAG, and a downstream primer R2 is AGTGCTCTGTCAGCTCTTGC; taking the obtained cDNA as a template, carrying out PCR amplification of the FSHR gene, and extracting the PCR product by a Tiangen gel extraction kit; and adding an A tail into the PCR product, and cloning, sequencing and verifying an T vector. The obtained FSHR full-length coding region sequence with the multiple splice forms is characterized by comprising the oFSHR695, oFSHR694, oFSHR648, oFSHR633 and oFSHR595.
Owner:新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心
Method for detecting microbial community structure of pu'er tea
InactiveCN103361413AComprehensive and systematic analysisHigh continuous stabilityMicrobiological testing/measurementFreeze thawingCommunity structure
The invention discloses a method for detecting the microbial community structure of pu'er tea. The method is implemented through collecting microbial bacteria of tea leaves of the pu'er tea by using a glass bead oscillating method; then, extracting a total microbial DNA by using the combination of a liquid nitrogen freezing-thawing and enzymatic method and a CTAB (cetyl trimethyl ammonium bromide) method; carrying out PCR (polymerase chain reaction) amplification on the extracted genomic DNA (deoxyribonucleic acid) by respectively using universal primers of bacterial 16S rRNA and fungal 18S rRNA variable regions; separating a PCR product by using DGGE (denaturing gradient gel electrophoresis) and dyeing the obtained product so as to obtain a band map, and carrying out relative quantitative analysis on bands by using Quantity One software; carrying out cut gel extraction on the DNA of the bands, carrying out the PCR amplification on extracted nucleic acids, connecting a product with a T carrier, and selecting positive clones to carry out community PCR with a GC-clamp; carrying out comparison again by using DGGE electrophoresis, and selecting a PCR product corresponding to a target band to carry out sequencing identification. The method disclosed by the invention can be used for detecting the changes of the microbial community structure and relative quantity of the pu'er tea in the process of fermentation.
Owner:SOUTH CHINA UNIV OF TECH
Fish skin and pig skin compounded nutrition crystal jelly and preparing method thereof
The invention belongs to the field of food processing and mainly relates to fish skin and pig skin compounded nutrition crystal jelly and a preparing method thereof. Fish skin and pig skin serve as raw materials, an extract gel solution is extracted through heat extraction, a primary extract gel solution is obtained through boiling, secondary gel extraction is carried out through steaming, the extract gel solution is cooled at a low-temperature to form the jelly food, the gel property pf the product is high, nutrition is rich, the texture is crystal clear, and the fat content is very low. The jelly prepared by compounding the pig skin and the fish skin is moderate in hardness, elasticity and toughness and has good heat resistance and stability.
Owner:BOHAI UNIV
Escherichia coli for producing isoeugenol monooxygenase and construction method and application of Escherichia coli
ActiveCN104031873AHas potential industrialization valueHas industrial valueBacteriaMicroorganism based processesEscherichia coliIsoeugenol
The invention discloses an Escherichia coli for producing isoeugenol monooxygenase and a construction method and an application of Escherichia coli. The Escherichia coli is named as BL21 (DE3) IEM-PP, and the preservation number is CGMCC No. 8918. The construction method comprises the steps of amplifying whole genome DNA of soil as a template by a PCR (polymerase chain reaction) technology under the action of PCR primers to obtain fragments of which the lengths are 1438bp, carrying out gel extraction and recovery, purifying and linking with a T-vector pET21 (a) to obtain the recombinant strain BL21 (DE3) IEM-PP cloning vector recombinant plasmid PET21 (a)-IEM. The Escherichia coli can be applied in producing vanillin by the biotransformation of isoeugenol via the recombinant strain.
Owner:中科阿尔诺(深圳)生物科技有限公司
Molecular markers for identifying high temperature-resistant porphyra haitanensis strain and construction method for molecular markers
InactiveCN102660646AThe result is accurateReliable resultsMicrobiological testing/measurementDNA preparation3-deoxyriboseElectrophoresis
The invention discloses molecular markers for identifying a high temperature-resistant porphyra haitanensis strain and a construction method for the molecular markers and relates to porphyra haitanensis. The molecular markers for identifying the high temperature-resistant porphyra haitanensis strain are Z-26-600 and Z-26-360. The construction method comprises the following steps of: collecting porphyra haitanensis materials; extracting total deoxyribose nucleic acid (DNA); performing random amplified polymorphic (RAPD) sweep analysis; performing electrophoresis detection of an RAPD amplification product; performing gel extraction on specific bands and recovering, and sequencing; designing sequence characterized amplified region (SCAR) maker primes; and verifying SCAR markers. A method foridentifying the high temperature-resistant strain by using the SCAR markers comprises the following steps of: collecting the porphyra haitanensis materials; extracting total DNA; performing polymerase chain reaction (PCR) amplification; performing electrophoresis detection of a PCR amplification product; and judging according to a result.
Owner:JIMEI UNIV
Method for extracting medical material-based collagen from fish scales
InactiveCN106032546AMaintain natural structureGood colorConnective tissue peptidesPeptide preparation methodsEthylenediamineFreeze-drying
The present invention provides a method for extracting medical material-based collagen from fish scales. The method comprises: (1) washing fish scales: using a decolorizing agent and hydrogen peroxide to decolorize the fish scales, and washing the decolorized fish scales; (2) placing the fish scales in an ethylenediaminetetraacetic acid solution, stirring, changing the ethylenediaminetetraacetic acid solution every 10-15 h, and draining the water; (3) carrying out stirring washing on the fish scales; (4) placing the fish scales into an acetic acid solution, adding protease to carry out enzymolysis gel extraction, centrifugating, and taking the supernatant; (5) adding the supernatant to a saturated NaCl or (NH4)2SO4 solution, standing, centrifugating, taking the precipitated crude collagen, and carrying out dialysis purification; and (6) carrying out freezing drying. According to the present invention, with the prepared collagen, the nature structure of the collagen can be well maintained; the fish scales are subjected to the decolorizing pre-treatment, such that the melanin on the surface of the fish scales is removed, and the color of the collagen is improved; the collagen purity is improved; and with the enzymolysis collagen extraction, the collagen yield is improved.
Owner:SHANGHAI FISHERIES RES INST
Urechis unicinctus farming method
InactiveCN107439437AIncrease productionPromote oxidation reactionFood processingClimate change adaptationBiotechnologySelenium methionine
The invention discloses an urechis unicinctus farming method. By applying a micropore oxygenation technology to an urechis unicinctus pond and in cooperation with the selenium-added feed, the growth effect of urechis unicinctus living on the bottom layer is promoted, the yield of urechis unicinctus is increased, and selenium-rich urechis unicinctus with rich nutrition is produced. The selenium-added feed is prepared from eucheuma gel extraction residue extract, degummed kelp powder, sargassum powder, scallop meat powder, shrimp shell powder, medical stone powder, squid organ meal, shell powder, sweet potato leaves powder, bile acid and selenium methionine.
Owner:FOSHAN SANSHUI JIAXIN AGRI TECH RES INST GENERAL PARTNERSHIP
Oral recombinant protein TAT-GH for promoting ricefield eel growth, and preparation method and application thereof
ActiveCN102766645AHigh expressionPromote recoveryBacteriaMicroorganism based processesBiotechnologyOral medication
The invention discloses an oral recombinant protein TAT-GH for promoting ricefield eel growth, and a preparation method and application thereof. The preparation method comprises steps of: A. synthesizing a GH gene of ricefield eel according to a known sequence; B. amplifying a protein transduction domain polypeptide TAT through a PCR method, and fusing with the GH gene; C. fusing the gene and a plasmid by a double digestion TAT-GH, and carrying out gel extraction on fragments containing the TAT-GH gene and open-loop fragments to obtain a TAT-GH plasmid; D. transforming the plasmid to a competence BL21 (DE3) to obtain a positive clone which is an objective strain; and E. separating and purifying protein expressed by the objective strains. The purified TAT-GH recombinant protein can effectively promote the growth of ricefield eel by oral administration, and provides a basis for the preparation of TAT mediated oral recombinant protein.
Owner:HUBEI TAIYANGHONG BIOLOGICAL TECH CO LTD
Detection method of gene related to alcohol metabolism
The invention discloses a detection method of a gene related to alcohol metabolism. The detection method comprises the specific steps that DNA of a detected person is extracted, and the concentration of the extracted DNA is not lower than 10 ng / ul, 260 / 280=1.8; SEQ NO 1 and SEQ NO 2 are utilized to amplify the rs1229984SNP locus of an ADH1B gene, SEQ NO 3 and SEQ NO 4 are utilized to amplify the rs671SNP locus of an ALDH2 gene, SEQ NO 5 and SEQ NO 6 are utilized to amplify the rs3813867 and rs2031920 SNP loci of a CYP2E1 gene, and the extracted DNA serves as a template to conduct PCR reaction; the three pairs of primers are subjected to agarose gel electrophoresis which is 1% of a common PCR amplification product; the 1% agorose gel electrophoresis strip is used for recycling a target strip by using an agarose gel extraction kit; sequencing reaction is conducted; a product obtained through the sequencing reaction is purified, denatured, and subjected to sequencing on a 3730 sequenator; and Chromas software is utilized to analyze the four SNP gene types from the sequencing result. The detection method of the gene related to alcohol metabolism has the advantages of being capable of conveniently conducting detection, high in detection accuracy and the like.
Owner:安徽安龙基因科技有限公司
Extraction of microbiological polysaccharide-hot gel
Extraction of microbial polysaccharide-thermal gel is carried out by taking fecal alkali bacterium as fermented broth, centrifugalizing to obtain deposit, washing for 4 times by deionized water, washing by alcohol, drying and crushing to obtain the final product. It costs low.
Owner:JIANGNAN UNIV
Production process of refined low-temperature instant agarose
The invention discloses a production process of refined low-temperature instant agarose and relates to the technical field of production of agar. The production process comprises the following steps: (1) taking common agar as the raw material of low-temperature instant agar, improving under a conventional agar production process, and refining and purifying the agar; (2) treating via 95% alcohol; (3) treating via alkali; (4) washing; (5) acidizing; (6) washing: fully washing the acidized agar with water till the pH is about 7.0; (7) extracting gel; (8) centrifuging and removing impurities; (9) granulating and drying; (10) sterilizing by using microwave; and (11) obtaining a finished product. The low-temperature instant agar is characterized in that the agar is improved under the conventional agar production process, the agar is subjected to gel extraction and purification; compared with the common agar, the refined and purified agar is relatively light in appearance color and few in impurities, is clear and transparent after the agar is dissolved, and can also be rapidly dissolved under lower temperature.
Owner:广东凯闻生物科技有限公司
Detection method of residual polychlorinated biphenyl in cosmetics with gas chromatography-mass spectrum method
InactiveCN101718764ALow detection limitHigh sensitivityComponent separationLower limitPolychlorinated biphenyl
The invention relates to a detection method of residual polychlorinated biphenyl, in particular to a detection method of residual polychlorinated biphenyl in cosmetics with gas chromatography-mass spectrum method; in the method, a sample is extracted in an accelerating way by solvent, normal hexane is used as extractant, and then gel extraction and Florisil cartridge purification are carried out, and then the gas chromatography-mass spectrum method, selected ion canning detection and an external standard method are used for quantifying. The detection method has the following characteristics that: 1. in the method, the gel extraction and Florisil cartridge purification are firstly combined to measure residual polychlorinated biphenyl in cosmetics. 2. the solvent is adopted to carry out extraction in an accelerating way, and the gel extraction and Florisil cartridge purification are adopted, the gas chromatography-mass spectrum method is used for quantifying and determining the nature, and seven kinds of polychlorinated biphenyl in the matrix of the cosmetics are measured, and the method has the advantages of low detection limit and high sensitivity; the measuring low limit of PCL-180 which has the lowest response is 0.01mug.ml-1, and the linear range is set from 0,01mug.ml-1-0.10mug.ml-1.
Owner:THE INSPECTION & QUARANTINE TECH CENT ZHEJIANG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Deer species source identification primer pair for cornua cervi pantotrichum products and identification method of deer species source identification primer pair
PendingCN111808975ARealize integrated and accurate identificationAvoiding the problem of false positivesMicrobiological testing/measurementDNA/RNA fragmentationBiotechnologyTissue sample
The invention discloses a deer species source identification primer pair for cornua cervi pantotrichum products. The identification primer pair comprises a deer identification primer pair DcF-DcR anda cornua cervi pantotrichum identification primer pair Rdfp-Rdrp. The invention also provides an identification method of the deer species source identification primer pair for the cornua cervi pantotrichum products. The method comprises the following steps: S1, preparing a preservation solution of a sample; S2, extracting DNA; S3, identifying the tissue sample by a deer identification program; and S4, determining the sequence after identification by the identification program of cornua cervi pantotrichum to judge the specific species of the cornua cervi pantotrichum product. The identification primer pair has the beneficial effects that integrated and accurate identification of deer and cornua cervi pantotrichum products is achieved by the deer identification primer pair and the cornua cervi pantotrichum identification primer pair; by big data analysis of deer genome sequence, identification accuracy of the cornua cervi pantotrichum product is improved; by first deer identification and then the cornua cervi pantotrichum identification program, accurate identification is achieved; and multiple groups of controls are set, the purified and identified products are recovered by gel extraction, and sequencing and analyzing are performed, so that accurate identification is achieved.
Owner:长春科技学院
Separation reagent, preparation method and applications of separation reagent, method for separating bacteria and gel extraction tube
ActiveCN112779176AReduce mortalitySimple processBacteriaMicroorganism separationBiotechnologyHigh concentration
The invention discloses a separation reagent, a preparation method and applications of the separation reagent, a method for separating bacteria and a gel extraction tube, and relates to the technical field of biological detection. The separation reagent includes a first component and a second component; the first component includes, by weight in parts, 10-30 parts of gel; and the second component includes 2*10<-3>-2.0 parts of a hemolytic agent, (0.01-0.5)*10<-3> parts of a centrifugal gradient regulating agent and a buffering agent, and the pH of the second component can be 7.2-7.6 through the using amount of the buffering agent. The separation reagent can well treat the nutrient solutions cultured by enriched blood to separate substance such as culture media, blood cells and activated charcoal in culture cultured by bacteria and blood, so that pure bacteria with high concentration can be obtained through quick separation, bacterial detection can be directly carried out after enriched blood culturing, therefore, detection speed can be accelerated, and the influences of the substances such as the culture media, the blood cells and the activated charcoal on bacterial detection can be reduced.
Owner:珠海恒屹生物科技有限公司
Promoter of watermelon ClCP2 gene and preparation method and application thereof
InactiveCN105420241AAvoid wastingHigh strengthPlant peptidesVector-based foreign material introductionEscherichia coliSequence design
The invention discloses a preparation method and application of a promoter of a watermelon ClCP2 gene. The preparation method comprises the steps that 1, PCR amplification is performed according to a pair of upstream sequence design primers which are in the size about 2 kb and are obtained through watermelon whole genome sequencing to amplify an upstream promoter sequence of the watermelon ClCP2 gene 5'; 2, watermelon leaf genome DNA is extracted through a CTAB method according to the upstream sequence design primers which are in the size about 2 kb and are obtained through watermelon whole genome sequencing, PCR amplification is performed by taking the watermelon leaf genome DNA as a template, after a gel extraction kit performs purification and recovery, a PCR product is connected to a pMD18-T carrier, competent cells of a escherichia coli DH5alpha strain are converted through a thermal stimulation method, the converted competent cells are picked for positive clone, PCR detection on the positive clone and enzyme cutting verification are performed, sequencing is performed, and then an upstream 2014-bp flanking sequence of the ClCP2 gene is obtained. The promoter has the good application potential on the aspects such as watermelon transgenosis safety.
Owner:WUHAN INST OF AGRI SCI
Technology with high utilization rate for extracting agar from gracilaria seaweed
The invention discloses a technology with high utilization rate for extracting agar from gracilaria seaweed. Seaweed bodies are pretreated with a low-alkali high-temperature method, consumption of alkali is reduced, and product strength is improved; gel extraction is performed with a high-temperature pressurization method, and the gel output rate is effectively increased; the production cycle canbe shortened; a multi-stage vibrating screen filtration technology is developed, the seaweed with gel incompletely output is filtered and returned to secondary gel extraction, waste is reduced, and the gel extraction rate is increased; meanwhile, residues are modified and processed to form fertilizer and feed additives, so that the comprehensive utilization rate of raw materials is greatly increased.
Owner:FUJIAN GOLD SWALLOW OCEAN BIOTECH
Automatic control system of glue-extracting working procedure in gelatine production course
InactiveCN101349913AIncrease productivityImprove product qualityGlue/gelatin preparationTotal factory controlProduction lineComputer control system
An automatic control system for the gel extraction in gelatin production comprises a gel extraction pot 1 containing a thermal insulating interlayer, a gel liquid circulating pipe at the bottom of the gel extraction pot 1, a water inlet cycle and a thermal insulation cycle which are provided on the gel extraction pot 1, wherein the thermal insulating interlayer of the gel extraction pot 1 is provided with the water inlet cycle and the thermal insulating cycle, a temperature increase cycle of the gel extraction pot 1 is composed by connecting a second electric adjusting valve 7-2, a second broken tube type heat exchanger 5-2, a third pump 2-3, a first electric three-way valve 11-1, a second electric three-way valve 11-2, a third electric three-way valve 11-3 and the gel extraction pot 1, a gel output cycle of the gel extraction pot 1 is composed by connecting the third electric three-way valve 11-3 with a gel dilution pot via a second flow meter 4-2 and a gel output electric ball valve. The automatic control system further comprises a PLC control unit, a manual control console and a computer control system for realizing gel extraction. The invention realizes the computer automatic control for gel extraction product lines, reduces the labor strength of workers, improves the working condition of workers and improves the efficiency and quality of gelatin production.
Owner:LANZHOU UNIVERSITY OF TECHNOLOGY
DNA gel extraction reagent and method for purifying PCR products by using reagent
The invention discloses a DNA gel extraction reagent and a method for purifying PCR products by using the reagent, wherein the DNA gel extraction reagent includes an agarose gel dissolving solution for extracting DNA gel and a scrubbing solution. A formula of the agarose gel dissolving solution for extracting the DNA gel comprises 6 mol / L of guanidine hydrochloride, 25 mmol / L of sodium citrate, 0.5% of lauroyl sarcosine, and 0.1 mol / L of 2-mercaptoethanol; a formula of the scrubbing solution comprises 10 mmol / L of Tris.HCl, 100 mmol / L of NaCl, 1 mmol / L of EDTA, and ethanol with the volume concentration of 80%, wherein the pH value of Tris.HCl is 8.0. The DNA gel extraction reagent can be used together with a regenerated silicon column, can reduce the use amount of disposable commercial kits, reduces the generation of laboratory waste, protects the environment, and saves social resources and use costs.
Owner:WUHAN UNIV OF SCI & TECH
Application of tag protein covalently bonded to substrate in CLIP
ActiveCN107828876ASimple and fast operationShorten the timeMicrobiological testing/measurementBiological testingCross-linkMagnetic bead
The invention discloses an application of a tag protein covalently bonded to a substrate in CLIP (cross-linking immunoprecipitation), and provides an application of a tag fusion protein covalently bonded to the substrate in a CLIP technology in a denaturant purifying manner. An RNA library used for sequencing is obtained by using the tag fusion protein covalently bonded to the substrate in a protein denaturant washing manner, and a result proves that an experiment result published in previous literatures can be well repeated. Steps of membrane transfer and gel extraction for recovering fragments in traditional CLIP processes are omitted. Labels covalently bonded to the substrate and a specific binder immobilized on a medium form covalent bonds, so strong washing of magnetic beads, which cannot be directly used previously, is added to the experiment operating steps, thereby the operation is simple, the operating time is saved, the CLIP process is optimized, and the loss possibly causedin the operating process is reduced.
Owner:INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
Method for reducing abrasion to bentonite gel extraction centrifugal machine from silicon particles
The invention aims at providing a method for reducing abrasion to a bentonite gel extraction centrifugal machine from silicon particles. After classification is conducted through a hydrocyclone and ahydraulic classification machine, the content of the silicon particles entering the centrifugal machine is reduced by 30%, and the granularity of the impurity particles is reduced to 44 microns from 150 microns. Compared with a traditional method, the traditional classification granularity is commonly 100 meshes, namely 150 microns; the hydrocyclone and the hydraulic classification machine are adopted for classification, and the classification granularity can reach 325 meshes namely 44 microns. After bottom flow of the hydrocyclone is classified through the hydrocyclone, the fine particles inoverflow return to pulping work, and the bottom flow is the silicon particles. The service life of the centrifugal machine is prolonged, the treatment capacity of the centrifugal machine is improved,and the extraction rate of gel minerals in the bentonite is guaranteed; meanwhile, the separation factor of the centrifugal machine can be improved, and accordingly high-quality inorganic gel productscan be produced; and the production cost is reduced, and the production capacity of a production line is improved.
Owner:安徽国创非金属矿业科技有限公司
Method for efficiently expressing Bombyx mori recombinant antibacterial peptides by using lactose culture medium
InactiveCN106148350ALow toxicityReduce instabilityNucleic acid vectorFermentationBiotechnologyEnzyme digestion
The invention relates to a method for efficiently expressing Bombyx mori recombinant antibacterial peptides by using lactose culture medium, comprising the steps of (1), using intestinal tissues of five-instar seven-days-old silkworms as a material to extract total RNA, designing three pairs of specific primers, carrying out RT-PCR (reverse transcription-polymerase chain reaction) to amplify Bombyx mori antibacterial peptide cecropinB6, cecropinD and moricin genes, detecting PCR products by 2.5% agarose gel electrophoresis, and purifying BmcecropinB6, BmcecropinD and Bmmoricin by using a gel extraction kit; (2), subjecting three antibacterial peptide genes and pET-32a expression vector respectively double-enzyme digestion by using NcoI / XhoI to establish pET32a-BmcecropinB6, pET32a-BmcecropinD, pET32a-Bmmorincin expression vectors, and sequencing by dideoxy chain termination; (3), using a lactose medium method to induce the expression of BmcecropinB6, BmcecropinD and Bmmoricin antibacterial peptides. The expression yield of BmcecropinB6, BmcecropinD and Bmmoricin recombinant proteins is significantly increased, and new technical choices are provided for the application in the fields such as purification and activity identification for Bombyx mori peptides, and cosmetics.
Owner:HONGHE COLLEGE
Method for extraction and diversity analysis of microbial total DNA in ship ballast water
ActiveCN104946627BHigh purityHelp removeMicrobiological testing/measurementDNA preparationFiltrationDigital analysis
Owner:SHANGHAI OCEAN UNIV
Automatic control system of glue-extracting working procedure in gelatine production course
InactiveCN101349913BIncrease productivityImprove product qualityGlue/gelatin preparationTotal factory controlProduction lineComputer control system
Owner:LANZHOU UNIVERSITY OF TECHNOLOGY
Preparation method and applications of rape BnRabGDI3 promoter
ActiveCN102965374BTissue-specific expression functionImprove securityFermentationPlant genotype modificationGenomic sequencingStaining
Owner:INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Method and reagent for constructing nucleic acid double-linker single-strand cyclical library
InactiveUS20170349893A1Simple processSimple stepsMicrobiological testing/measurementLibrary creationSingle strandNucleobase
A method and reagent for constructing a nucleic acid double-joint single-strand cyclical library. The method comprises: breaking a nucleic acid into nucleic acid fragments; connecting a first linker sequence; producing by amplification a first product provided with the first linker sequence at either end, where a U nucleobase is provided on a primer sequence; using USER enzyme to cleave the first product and cyclizing to produce a gap; or, a nicking enzyme recognition sequence is also provided on the primer sequence, using the USER enzyme to cleave the first product, cyclizing and using a nicking enzyme for nicking to produce a nick; performing a restrictive nick / gap translation reaction from the nick or the gap; removing by digestion any portion that did not undergo the restrictive nick / gap translation reaction; connecting a second linker sequence; producing by amplification a second product provided with the second linker sequence at either end; denaturing the second product, and using a mediated sequence for cyclization of a single-strand nucleic acid molecule. The method allows an increase in the length of library insert fragments and obviates the need for gel extraction; the single-strand nucleic acid molecule can be cyclized directly when denatured with heat.
Owner:MGI TECH CO LTD
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Patsnap Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com