Recombinant bacillus subtilis EV71-VP1 expression vector and preparation method and application thereof
An EV71-VP1, Bacillus subtilis technology, applied in the field of genetic engineering, can solve the problem of no definite and effective vaccine, and achieve the effect of high safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Embodiment 1 constructs recombinant Bacillus subtilis EV71-VP1 expression vector, and carries out verification method as follows:
[0087] (1) Transferring the carrier protein gene:
[0088] (a) PCR method amplifies the (BGSC NO.1A771 strain) CotB gene regulatory sequence and coding sequence of Bacillus subtilis:
[0089] The upstream primer sequence for PCR amplification is: 5'GAATCCGAGTTTCGCAAGTCCT3';
[0090] The downstream primer sequence is: 5'CAAGCTTGGATGATTGATCATCTGAAGATTTT3';
[0091] Position: The enzyme cutting sites at both ends are EcoR I and HindIII respectively;
[0092] Amplification conditions are: 95°C for 4min, 30 cycles of amplification at 95°C for 30Sec, 53°C for 30Sec, and 75°C for 1min;
[0093] (b) Connect the above PCR amplification product to the pMD18T carrier (Dalian Bao Biological Kit), the reaction system is: 5 μL ligation buffer + 0.5 μL pMD18T vector + 4.5 μL target fragment; transform Escherichia coli DH5α, and send the positive PCR am...
Embodiment 2
[0128](1) The promoter and partial coding sequence (position -263~825nt) of the CotB gene (BSU36050cotB) of Bacillus subtilis were used as the carrier protein and the partial coding sequence of EV71VP1 was connected to the middle part of the integrated plasmid pDG1662 (BGSCAccession: ECE113) amyE gene .
[0129] Specific steps are as follows:
[0130] 1. Using the BGSC 1A771 strain genome as a template, pfu DNA polymerase was used to amplify the partial coding sequence of the carrier protein and its promoter by PCR.
[0131] The primer sequences are as follows:
[0132] Upstream: 5-AGCGCCGgaattcACGGATTAGGCCGTTTGTCC-3 (position: -263 / -244, containing EcoRI restriction site)
[0133] Downstream: 5-CAATCATCCaagcttGGATGATTGATCATCTGAAG-3 (position: +806 / +825, containing HindIII restriction site)
[0134] PCR amplification conditions: 95°C for 4min, (95°C for 30sec, 53°C for 30sec, 72°C for 1min) x 30 cycles.
[0135] Results: A 1088bp DNA fragment containing the CotB promoter a...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com