233 results about "Pseudomonas hydrophila" patented technology

The invention relates to an LAMP (Loop-mediated Isothermal Amplification) detection kit of pathogenic aeromonas hydrophila, having convenient use and rapid detection. The LAMP detection kit comprises a bacterium DNA extracting reagent and an LAMP reaction reagent, wherein the reaction reagent contains primers FIP with the sequence of GTTTCCCCCATCAGATCCGTGGTTTACGCCACCCAGTTTCTTG, BIP with the sequence of TCCGGCCTGTATACCTGTATCAGGTTAAACCAGGGTGTCATCGCT, F3 with the sequence of TGATGGCCACGAGACATCCA and B3 with the sequence of TGCTTGATCCCCTTGCTACT. The LAMP detection method of the pathogenic aeromonas hydrophila comprises the following steps of: (1) DNA (Deoxyribonucleic Acid) extraction; (2) LAMP amplification of the pathogenic aeromonas hydrophila; and (3) staining detection. The invention is suitable for detecting the pathogenic aeromonas hydrophila.

The invention relates to antisepsis and anti-inflammation medicaments, and particularly relates to high-content liquid povidone-iodine. The liquid povidone-iodine is prepared from the following raw materials in percentage by weight: 5.2-12.24 percent of iodine, 10-24 percent of polyvinylpyrrolidone, 2-4.8 percent of potassium iodide, 0.1-0.24 percent of potassium iodate, 15-36 percent of ethanol and the balance of water. The high-content liquid povidone-iodine is a reddish brown viscous liquid, is easily dissolved in water, has stable performance, strong sterilization efficacy and no irritation, is suitable for sterilization of operating parts and skin-mucosa or sterilization of aquatic water, can be used for preventing and treating bacteriosis of aquatic animals caused by vibrio, aeromonas hydrophila, edwardsiella tarda and the like and sterilizing the environment of livestock and poultry housings, plays a role in killing multiple bacteria, spores, viruses, fungi and the like, thus being a good iodine containing medical bactericide and epidemic prevention sanitizer.

The invention provides a Chinese herbal medicinal prescription for preventing and treating an aeromonas hydrophila fish disease. The prescription comprises the following components by weight: 90 to 150g of golden thread, 90 to 150g of Chinese rhubarb, 90 to 120g of baical skullcap root, 80 to 110g of isatis root, 80 to 110g of weeping forsythiae capsule, 80 to 110g of purple perilla, 80 to 100g of grassleaf sweelflag rhizome, 80 to 100g of Chinese gall, 80 to 100g of ginger, 80 to 120g of garlic, and 2 to 5kg of flour. The processing method comprises the following steps: crushing Chinese herbal medicaments respectively, and screening all Chinese herbal medicaments through a 80-mesh screen; uniformly stirring and mixing with flour; adding water which accounts for 5 percent of the total weight of the Chinese herbal medicaments; and producing bait granules with different diameters with a feed granulator according to the sizes of fish to be prevented and treated. The prescription is a pure Chinese herbal medicinal prescription, cannot pollute the environment or be concentrated in a fish body. When the Chinese herbal medicament is manufactured, the flour is added to serve as adhesive of the Chinese herbal medicinal powder, granules with different diameters can be produced with the feed granulator, prevention and treatment of large-area fish disease can be facilitated, and the death rate of cultured fishes can be reduced to lower than 10 percent.

The invention discloses a multiple PCR primer set and probes and a detecting method for simultaneously detecting three kinds of aeromonas and discloses a detecting method for simultaneously and fast detecting aeromonas hydrophila (AH), aeromonas veronii (AV) and aeromonas schubertii (AS) and a primer set and probes used in the detecting method. The detecting method is characterized in that three pairs of characteristic primers and three nucleic acid probes are used and can distinguish the three aeromonas high in homology, and the three kinds of aeromonas are simultaneously detected and distinguished in a same pipe reaction system. By means of the primers and the probes and the detecting method, the three kinds of zoonosis pathogenic bacteria can be fast detected, and the advantages of easy and convenient operation, high sensitivity, good specificity and the like are achieved; suspected cases can be found and determined in time, and the detection level of the kind of pathogens can be improved.

The invention provides a plant extract formula for inhibiting aeromonas hydrophila, which belongs to the technical field of the development and the utilization of natural products. The formula comprises the following components in percentage by weight: 50 to 80 percent of Chinese gall, 10 to 30 percent of tea polyphenol and 5 to 15 percent of rhubarb extract. The plant extract compound formula prepared by the invention is formed by combining pure natural plant extracts, has the characteristics of significant antibacterial effect, no drug residues, no pollution to water body environments and the like, provides a new method for preventing and treating aquatic animal diseases caused by the aeromonas hydrophila, and can be used as Chinese medicament preparation and a feed additive.

The invention relates to a pediococcus pentosaceus G11 strain as well as screening and applications of the pediococcus pentosaceus G11 strain. The pediococcus pentosaceus G11 strain is preserved in the China Center for Type Culture Collection, and is assigned with the accession number of CCTCC NO:2016248. The pediococcus pentosaceus G11 strain has tolerance to compound sulfamethoxazole and ceftazidime, has antibacterial activity for vibrio parahaemolyticus, aeromonas hydrophila, vibrio alginolyticus, staphylococcus aureus and beta streptococcus, has certain stress resistance and enzyme producing ability, is free of hemocyte solubility, and has no drug tolerance for most antibiotics; the dipping bath experiment proves that the pediococcus pentosaceus G11 strain is harmless to the host, can improve the immunity of the body, has wide application prospects, can be applied to probiotic preparations, and also can be prepared into bacterial powder which is then added into a feed as a feed additive, further, the growth of pathogenic bacteria in the bodies of the animals is inhibited, so that the death rate of animals is reduced, and the pediococcus pentosaceus G11 strain is a probiotic brain worthy of development.

The invention discloses an expression product in series of two fish antibacterial peptide genes and an expression method thereof, relating to the gene engineering technology of marine organism, providing an expression product in series of the two fish antibacterial peptide genes and construction of an expression vector in series of two fish Hepcidin and a preparation method for the expression product in series. In the invention, two fish hepcidin genes are expressed in series by a pET32a prokaryocyte expression vector to realize the soluble expression of two antibacterial peptide hepcidin at the same time; the expression level of two antibacterial peptides in series is over 50mg / L, the soluble expression product in series is purified by a N-terminal His-Tag affinity chromatography, and then cuts off a protein label in series by enterokinase; and the cut mixture is purified by a Ni affinity chromatographic column to obtain a purified Hepcidin expression product in series. The purified expression product has obvious inhibiting effect on Staphylococcus aureus, Aeromonas hydrophila, micrococcus lysodeikticus and the like.

The invention relates to a gene chip in the detection of aquatic pathogenic microorganism, a preparation method and applications thereof in the detection of aquatic pathogenic microorganism. A conserved sequence selecting from a target pathogenic microorganism gene is fixed on a solid-phase carrier as an oligonucleotide probe, in the proper hybridization condition, a marked sample to be detected is added for reaction, and the corresponding aquatic pathogenic microorganism can be identified according to a probe display signal on the gene chip. The gene chip can fast detect the aquatic pathogenic microorganism such as aeromonas hydrophila, edwardsiella tarda, staphylococcus aureus, vibrio parahaemolyticus, listeria monocytogenes, salmonella typhimurium, shigella and the like, thus being high in detection sensitivity, and strong in specificity and greatly shortening the detection period.

The invention relates to a multifunctional special feed for Tadpole of Rants chensinensis. The technical proposal adopted is that the feed consists of main materials and auxiliary materials; wherein, every ton of the main materials consists of 200 to 400kg of rice bran, 100 to 200kg of corn meal, 100 to 200kg of fish meal, 100 to 300kg of bean pulp powder, 100 to 200kg of meat meal, 50 to 100kg of wheat-middling and 20 to 70kg of wheat bran; every ton of the main materiala is added into the following auxiliary materials by weight: 200 to 800g of microbial inoculum agent, 200 to 500g of aquaculture vitamin complex, 200 to 500g of aquaculture compound mineral, 200 to 500g of antioxidant, 20 to 100g of inactivated aeromonas hydrophila vaccine and 20 to 50g of diethylstilbestrol. The preparation method is that firstly, the main materials are smashed, stirred; and then the auxiliary materials are added into the main materials and are stirred evenly, regulated in steam, granulated and cooled. The feed has the functions of sex induction and disease prevention for the Tadpole of Rants chensinensis.

The invention relates to the technical field of feed, in particular, to a compound plant extract feed additive and a preparation method thereof. The invention aims to provide a compound plant extract feed additive with a strong antibacterial effect for solving various defects such as existence of toxic and side effects caused by adding other synthetic drugs such as antibiotic in the feeds, and excellent effects are achieved. The technical scheme of the invention is to provide the compound plant extract feed additive, which comprises citrus essential oil, allicin, tangeritin, pine needle meal and pine flower essential oil. The compound plant extract feed additive has the following benefits: based on the traditional Chinese herbal medicine theoretical research and practice, 4 traditional Chinese herbal medicines and 5 extracts are chosen, the in-vitro antimicrobial activities thereof are measured, and plant extracts having restraining effect to aeromonas hydrophila are selected out to prepare compound preparation. The compound plant extract feed additive has the characteristics of excellent in-vitro antimicrobial activity, high efficiency, safety, no poison and no residue for long-time use.

The invention discloses a lysozyme-containing grass carp feed, which comprises the following components in percentage by weight: 23.36 percent of soybean meal, 18.91 percent of rapeseed dregs, 14.5 to 14.9 percent of wheat bran, 15 percent of wheat meal, 11.72 percent of flour, 6.24 percent of fish meal, 5 percent of rice bran, 1.5 percent of calcium dihydrogen phosphate, 1 percent of 50 percent choline, 1 percent of soybean oil, 0.5 percent of composite minerals, 0.5 percent of composite vitamins, 0.27 percent of salt, and 0.1 to 0.5 percent of lysozyme. The lysozyme is added in the grass carp feed, and the lysozyme has the functions of dissolving microbial cell walls, resisting bacteria and viruses, stopping bleeding, diminishing swelling, easing pain, quickening tissue repair and the like, so the feed can improve the nonspecific immune function of grass carp and inhibit the grass carp from being infected by aeromonas hydrophila.

The invention discloses a method for preparing urechis unicinctus glycosaminoglycan and antibacterial peptide simultaneously. The method includes: raw material process, producing raw material of urechis unicinctus into a homogenate; enzymolysis; ultrafitration; preparation of glycosaminoglycan, eliminating protein, ethanol precipitation and washing, anion exchange column chromatography, gel filtration chromatography to obtain glycosaminoglycan with high purity; and preparation of the antibacterial peptide. According to the method, the reaction condition is mild, the preparation process is environment-friendly and energy-saving, and the added value of products is high; the purity of the prepared glycosaminoglycan and the antibacterial peptide is high; a large amount of protein can be recycled, the comprehensive utilization of the urechis unicinctus is facilitated, the prepared glycosaminoglycan has obvious effects of anticoagulant and free radical scavenging, and the prepared antibacterial peptide has obvious bacteriostatic activity to staphylococcus aureus, Escherichia coli, Aeromonas hydrophila and the like; and the obtained glycosaminoglycan and the urechis unicinctus can provide fine immunopotentiators and novel antibacterial agents for marine rare life aquaculture.

The invention discloses a Lactobacillus zeae LZ3. The preservation number of the above strain is CCTCC NO:M2015652, and the Lactobacillus zeae LZ3 has Aeromonas hydrophila growth or breeding inhibition ability. The strain can be used as an Aeromonas hydrophila antagonistic microorganism to prepare a bacteriostasis preparation which can be applied to the aquaculture in order to prevent harms of the Aeromonas hydrophila to cultured aquatic products; and the strain can be used to grade ammonia nitrogen, nitrite and other harmful substances in aquaculture water as a probiotic preparation in order to improve the culture water quality.

The invention belongs to the technical field of microorganisms and discloses a preparation method and application of a compound microbial substrate modifier with an aquatic pathogen antagonistic characteristic. Two strains namely bacillus subtilis AB-90008-15 and lactobacillus gasseri 88 are provided, and the compound microbial substrate modifier is obtained by strain activation, fermentation culture, centrifugal strain collection and vacuum drying and grinding. The compound microbial substrate modifier has an antagonistic action on aquatic pathogens such as aeromonas hydrophila, aeromonas sobria, aeromonas veronii, aeromonas caviae, Edwardsiella tarda, listonella anguillarum, vibrio parahaemolyticus and vibrio alginolyticus and is capable of degrading carbonaceous organics and nitrogenousorganics in pond sediment, promoting sediment mineralization, reducing contents of total nitrogen, total phosphorus, nitrite, ammonia nitrogen and COD of aquaculture water, promoting virtuous cycle of waternutrients, preventing accumulation of toxic and harmful substances and improving an aquaculture substrate ecological environment.

The invention relates to the microbial field, in particular to a microorganism agent for recovering the organic polluted water and preparation process and using method. The microorganism agent consists of aerobic microorganisms, in particular to pseudomonas fluorescens, alcaligeneseutrophus, aeromonas hydrophila, ArthrobacterSimplex and bacillus megaterium with the weight ratio is 1:1:1-4:2-6:3-12, and the residual is the culture liquid containing nitrobenzene. The degradation rate can reach between 97.7 percent and 100 percent when the invention is implemented in the polluted water containing nitrobenzene. The microorganism agent of the invention is made by that the nitryl aromatic hydrocarbon compound and the nutrition compound with relatively high concentration are acclimatized and sorted, and has strong growing and reproductive ability as well as adaptability; besides, the invention can assure the higher biomass in the environment at low cost, and does not cause secondary pollution and has the effect of continuously strengthening the purification of the water, ,thereby having good social, economic and ecological benefits.

A traditional Chinese herbal medicine preparation for treating aeromonas hydrophila diseases of freshwater fish is prepared by the following active pharmaceutical ingredients by weight: 3-5 parts of rheum officinale, 3-5 parts of polygonum cuspidatum, 2-4 parts of pericarpium citri reticulatae, 2-4 parts of coptis chinensis, 2-4 parts of cortex phellodendri, 1-2 parts of prunella vulgaris and 1-2 parts of liquorice. A preparation method of the traditional Chinese herbal medicine preparation comprises the steps of weighing the rheum officinale, the polygonum cuspidatum, the pericarpium citri reticulatae, the coptis chinensis, the cortex phellodendri, the prunella vulgaris and liquorice decoction pieces according to the weight ratio and smashing the active pharmaceutical ingredients into crude powder; extracting volatile oil of the pericarpium citri reticulatae crude powder and the prunella vulgaris crude powder; adding water into crude powder of the rheum officinale, the polygonum cuspidatum, the coptis chinensis, the cortex phellodendri and the liquorice to perform soaking, decocting the soaked crude powder of the rheum officinale, the polygonum cuspidatum, the coptis chinensis, the cortex phellodendri and the liquorice and decoction dregs of the pericarpium citri reticulatae and the prunella vulgaris which are extracted to obtain the volatile oil for three times through slow fire, and filtering for three times to respectively obtain three filtrates; mixing the obtained three filtrates, and heating the mixed filtrates to obtain concentrated solution; and mixing the obtained volatile oil and the concentrated solution to obtain the traditional Chinese herbal medicine preparation. The traditional Chinese herbal medicine preparation is used for treating the aeromonas hydrophila diseases of freshwater fish, and is short in treatment course, low in treatment cost, high in curative rate, safe, free of side and toxic effects and convenient to take.

The invention discloses bacteriophage pAhMJG and application of the bacteriophage pAhMJG in treatment of fish diseases caused by aeromonas hydrophila. The preservation number of the bacteriophage pAhMJG preserved in the China Center for Type Culture Collection is CCTCC No: M 2019202. The whole length of a bacteriophage pAhMJG genome is 45,057 bp; and the genome is a linear double-stranded DNA andcontains 45 open reading frames. The bacteriophage pAhMJG does not contain sRNA, tRNA or rRNA, also does not contain antibiotic genes, virulence genes or lysogen related genes, has an obvious killingeffect on aeromonas hydrophila, can be used for treating fish diseases caused by aeromonas hydrophila, and has a wide application prospect.

The invention discloses a preparation method of microcapsule vaccines capable of resisting the infection of aeromonas hydrophila, relating to the field of the preparation of antibacterial vaccines and solving the problems of time and labor wasting and difficult in large-scale popularization during the practical operations of cultivating fish and the like with immunotherapy by means of vaccine injection. The preparation method of the microcapsule vaccines capable of resisting the infection of the aeromonas hydrophila comprises the following steps of: (1) the preparation of aeromonas hydrophila suspension: inoculating the aeromonas hydrophila to prepare the aeromonas hydrophila suspension with the effective viable bacteria content of 1010 per ml, inactivating the aeromonas hydrophila suspension with formalin, and storing the suspension; and (2) the preparation of the microcapsule vaccines of the aeromonas hydrophila: uniformly mixing the aeromonas hydrophila suspension prepared in the step (1) and a 5% sodium alginate solution in the proportion of 1:1 in a vortex oscillator, and performing spraying and drying treatment on the mixture to obtain microcapsule particles. The method can be used for preparing the microcapsule vaccines for preventing and treating bacterial septicemia of sturgeon, particularly acipenser baeri.

The invention provides a recombinant plasmid, a multi-titer live vaccine as well as preparation methods and the application thereof. The provided recombinant plasmid contains a fusion gene sequence ofsignal peptides of vibrio anguillarum metalloprotease and aeromonas hydrophila 3-glycerophosphate dehydrogenase; the preparation method of the recombinant plasmid comprises the following steps: (A) establishing signal peptide-3-glycerophosphate dehydrogenase fusion gene; (B) enzyme-cutting the fusion gene and a carrier; and (C) connecting the enzyme-cutting fusion gene and the enzyme-cutting carrier. The multi-titer live vaccine is prepared by converting the recombinant plasmid into vibrio anguillarum attenuated strains; and the preparation method of the multi-titer live vaccine comprises thefollowing steps: (A) establishing the recombinant plasmid containing signal peptides of vibrio anguillarum metalloprotease and aeromonas hydrophila 3-glycerophosphate dehydrogenase; and (B) converting the recombinant plasmid obtained in the step (A) into vibrio anguillarum attenuated strains. The multi-titer live vaccine is applied to prevent and treat fish diseases caused by vibrio anguillarum and aeromonas hydrophila. The attenuated vaccine provided by the invention has remarkable multi-titer immune protective efficiency, can be used as the live vaccine of vibrio anguillarum and aeromonas hydrophila and has favorable application prospect.

The invention provides a pichia pastoris-optimized oncorhynchus mykiss hepcidin gene sequence. Four recombinant plasmids pGAPZAlpha A / pPICZAlphaA-hep and pGAPZAlphaA / pPICZAlphaA-mhep are constructed by utilizing hepcidin genes or segments thereof, and are respectively electrotransformed into pichia pastoris GS115 and KM71H host cells to obtain a recombinant pichia pastoris strain, the recombinant pichia pastoris strain is subjected to culture expression to obtain expression polypeptide with the multi-bacteria resistance activity. The expression polypeptide has stronger bacteriostatic activity on escherichia coli, staphylococcus aureus and a part of fish pathogenic bacteria (vibrio parahaemolyticus 1.2164, aeromonas veronii X-1-06909, aeromonas hydrophila HA-336, and aeromonas veronii CL0901).

The invention relates to the technical field of establishment of animal experiment models and in particular relates to a method for establishing a fish inflammatory bowel disease model and the established model thereof. The method comprises the following steps: injecting aeromonas hydrophila with the collection number of CCTCC NO.M2013089 into a soaked anaesthetic healthy fish through anus perfusion, breeding and selecting fish with the symptom of the inflammatory bowel disease as the fish inflammatory bowel disease model. According to the method, the aeromonas hydrophila is directly filled in the intestinal tract of the fish, and the process that the pathogenic bacteria enter blood through intramuscular injection or intraperitoneal injection and act on the intestinal tract through blood circulation is avoided, so that the pathogenic bacteria directly act on the intestinal tract, and the pertinence is improved; furthermore, the established model has high stability and repeatability, and because the aeromonas hydrophila is wide in infection spectrum, the established method can be widely applied to multiple fishes.

The invention relates to growth-inhibitory composition against pathogenic bacteria of meat based food stuff comprising IgY. The IgY is a specific immunoglobulin derived from yolk of egg. 12 representative bacteria and other microbes deteriorating quality of process meat products that the IgY of the invention targets include Aeromonas hydrophila, Bacillus cereus, which comprises Aeromonas hydrophil, Bacillus cereus, Camphlobacter jejuni, Clotridium perfringens, 0157:H7 (Escherichia col, 0157:H7), Lactobacillus, Listeria monocytogens, Saccharomyces cerevisiae, Salmonella enteritidis, Salmonella typhimurium, Staphylococcus aureus, Staphylococcus epidermidis. The 12 representative bacteria antigen forms are respectively injected the interior of chicks to obtain the IgY of the 12 antigens.

The invention discloses eel aeromonas hydrophila and edwardsiella tarda bigeminal recombinant protein and a preparation method thereof. The bigeminal recombinant protein disclosed by the invention comprises an aeromonas hydrophila type II pore protein membrane outer part and an edwardsiella tarda ompS2 membrane outer part which are connected together, and the amino acid sequence of the bigeminal recombinant protein is as shown by SEQ ID NO1. According to the preparation method disclosed by the invention, the aeromonas hydrophila type II pore protein membrane outer part and the edwardsiella tarda ompS2 membrane outer part are connected together through a genetic engineering means to construct the bigeminal recombinant protein, and the bigeminal recombinant protein can prevent inflections of aeromonas hydrophila and edwardsiella tarda at the same time after being used for immunizing eels, and has a better immune effect compared with immunization with single outer membrane protein. The bigeminal recombinant protein disclosed by the invention can obtain an immune effect on a variety of pathogenic bacteria through only once injection on a fish body, so that injuries to the fish body are reduced, and immunization steps are simplified; the preparation method of the bigeminal recombinant protein is suitable for industrial production.

The invention provides a pediococcus pentosaceus NHB-PpA9601. The pediococcus pentosaceus NHB-PpA9601 is separated from intestinal tracts of white feather broilers, and is preserved in China General Microbiological Culture Collection Center (CGMCC for short, the address is Institute of Microbiology, Chinese Academy of Sciences, 3 #, 1 # yard, West Beichen Road, Chaoyang District, Beijing, the postal code is 100101), the preservation number is CGMCC NO.22646, and the preservation date is May 31, 2021. The pediococcus pentosaceus NHB-PpA9601 has the advantages that the obvious probiotic property is realized, the growth and reproduction of pathogenic bacteria such as intestinal pathogenic escherichia coli, staphylococcus aureus, salmonella suis, salmonella choleraesuis, salmonella gallinarum, salmonella pullorum, salmonella typhimurium, salmonella, shigella, bacillus perfringens, proteus penneri, aeromonas hydrophila and vibrio parahaemolyticus can be effectively inhibited; the pediococcus pentosaceus NHB-PpA9601 can be used for producing a wet-based fermented feed, and can be used for effectively improving intestinal health and increasing economic benefits.

The invention discloses a preparation method and application of a fish-derived galactose lectin CaGal recombinant protein, and belongs to the field of aquatic animal molecular biology. According to the technical scheme, the cDNA of Qihe crucian carp Carassius auratus is took as a template, F / R is used as the primer for carrying out PCR amplification, the PCR product CaGal is connected with a carrier pET-32a to construct pET-32a-CaGal recombinant expression vector; the vector is transformed into escherichia coli BL21 (DE3) to obtain the escherichia coli expression strain pET-32a-CaGal-BL21 which can express the galactose lectin CaGal recombinant protein, and the galactose lectin CaGal recombinant protein can be obtained through separation and purification. The galactose lectin CaGal recombinant protein can keep the natural biological activity, so that pathogenic bacteria such as aeromonas hydrophila can be effectively inhibited, the antibacterial effect is obvious, and the preparation method is simple and can be used as a novel fish immune additive or an antibacterial drug.

It is an objective of the present invention to provide a composition, e.g. in form of an immunogenic composition or a vaccine for the protection of fish against infection from Aeromonas hydrophila. The present invention furthermore relates to a combination of immunogenic amounts of two highly virulent Aeromonas hydrophila strains, one belonging to biotype A and one belonging to biotype B, e.g. in an immunogenic composition or in a vaccine, in order to providing efficient prophylactic protection of against infection caused by Aeromonas hydrophila.

The invention relates to the technical field related to elimination of thalli, and particularly provides a preparation for strongly eliminating vibrios and a preparing method of the preparation. On one hand, provided is the preparation for strongly removing vibrios, wherein the preparation comprises the components in percentage by weight: 65-85% of a first guanidine derivative, 2-12% of a second guanidine derivative and the balance being ethanol, wherein the first guanidine derivative is polyhexamethylene guanidine salt and / or polyhexamethylene biguanide salt; and the relative molecular weightof the second guanidine derivative is 500-1500. The vibrios can be effectively removed by utilizing polyhexamethylene guanidine hydrochloride and chlorhexidine hydrochloride under the specific content. The preparation provided by the invention has a strong removal effect on pathogenic vibrios, such as vibrio parahaemolyticus, vibrio anguillarum, vibrio alginolyticus, vibrio cholerae, vibrio fluorescens and the like, has a good cracking effect on aeromonas hydrophila, aeromonas punctata, escherichia coli, salmonella and other gram-negative bacteria, and has a quite high removal rate after being used for 48 hours.

The invention relates to streptomyces lateritius Z1-26, a microecological preparation and a preparation method of the microecological preparation, the streptomyces lateritius Z1-26 is preserved in the China Center for Type Culture Collection, and the strain preservation number is CCTCC NO: M 2021705. The microecological preparation prepared by fermenting the streptomyces lateritius Z1-26 is suitable for aquaculture, acts on freshwater fishes such as crucian carps, grass carps and carps in the form of a feed additive, has the protection rate of 60%, particularly has a remarkable effect of resisting infection of aeromonas hydrophila on the freshwater fishes, and can be used as a feed additive for aquaculture.Meanwhile, the growth performance and the immunocompetence of the freshwater fishes can be effectively improved.

The invention discloses a strain of lactobacillus plantarum Kmust-Li01. A preservation number of the lactobacillus plantarum Kmust-Li01 in the China General Microbiological Culture Collection Center of China Committee for Culture Collection of Microorganisms (CGMCC) is CGMCC No.21266. The strain disclosed by the invention is applied to inhibition of pathogenic microorganisms and has an inhibiting action on Escherichia coli (Escherichia coli), Aeromonas hydrophila (Aeromonas hydrophila), Pseudomonas aeruginosa (Pseudomonas aeruginosa), Streptococcus agalactiae (Streptococcus agalactiae), Staphylococcus aureus (Staphylococcus aureus) and Shigella Castellai (Shigella Castellai). The invention also provides a high-density fermentation method of the strain. The viable count in fermentation liquor prepared by the method can reach more than 10<11> magnitude; and the method provided by the invention is simple and is easy to operate and suitable for industrial production and market popularization and application.