209 results about "Bacterial dna" patented technology

The invention discloses an insect bioreactor capable of expressing multiple exogenous genes, and a construction method and application thereof. The construction method comprises the following steps: (1) introducing multicopy high-efficiency bacteria DNA (deoxyribonucleic acid) replication initiator into chitinase and cysteine proteinase genes of a baculovirus genome to obtain a baculovirus shuttle plasmid; (2) replacing virus duplicated essential gene downstream the polyhedrosis gene of the baculovirus shuttle plasmid with antibiotic gene to obtain a baculovirus plasmid DNA; and (3) replacingother virus duplicated and infected nonessential genes in the baculovirus shuttle plasmid with reverse selection marker gene to obtain the insect bioreactor. The antibiotic gene or reverse selection marker gene in the insect bioreactor which is constructed by replacing the exogenous target genes can express multiple exogenous genes in a host insect or insect cell. The insect bioreactor disclosed by the invention can efficiently expressing one or more exogenous genes in an insect body at the same time, and can produce massive recombinant proteins at low cost.

Bis-quinazoline compounds based on the compound (3,4-Dihydro-quinazolin-2-yl)-quinazolin-2-yl-amine, and methods of use of the compounds as inhibitors of bacterial DNA polymerase holoenzymes and in the treatment of bacterial infections are described.

The invention discloses a method and a kit for extracting bacterial nucleic acid from sputa and applications thereof. The method is to use liquefaction reagent to liquefy a sputum sample and add solid particles to lyse cells to extract nucleic acid form the sputum. Overcoming the drawbacks of the prior method including complex procedures, a long period of time, complex operation and inadequate samples, the method of the invention for extracting nucleic acid samples is convenient and quick in operation, adequate in nucleic acid samples, low in cost and easy to implement. The method and kit for extracting bacterial nucleic acid can be used to identify strains of mycobacteria and to detect whether a gene locus of mycobacterium tuberculosis is of a wide type or a mutant type. With a chip for identifying strains and a chip for detecting whether the gene locus of mycobacterium tuberculosis is of a wide type or a mutant type, the method can identify the strains of mycobacteria and to detect whether a gene locus of mycobacterium tuberculosis is of a wide type or a mutant type in a quick, accurate and high-pass way.

Disclosed is a method of detecting bacteria in a biological sample, especially a blood sample, without the need for extensive sub-culturing of the sample. Nucleic acid present within the sample is isolated and bacterial DNA specifically amplified using primers that uniquely prime the amplification of 16s rRNA-encoding nucleic acid. The amplicons are then digested with an endonuclease to yield a restriction fragment length profile for the biological sample. The restriction fragment length profile for the biological sample is then compare to a database of profiles made using cultures of known bacterial species. A match between the sample profile and the database identifies the bacteria present in the sample.

The invention relates to a multiple PCR (polymerase chain reaction) method for identifying salmonella enteritidis, salmonella typhimurium, salmonella pullorum and salmonella gallinarum. The multi-PCR method comprises the following steps of: with the extracted DNA (deoxyribonucleic acid) of a bacterium to be detected as a template, carrying out mPCR (multiple polymerase chain reaction) amplification on five pairs of primers as shown in SEQ ID NO.1-10; and carrying out agarose gel electrophoresis on mPCR amplification products, and then determining according to electrophoresis results. According to the multiple PCR method, the synthesized primers are used for carrying out PCR amplification, a diseased material can be directly ground and amplified by adopting the established multiple PCR, different salmonella serotypes can be detected in one system, serum glass plate agglutination is completed in only about six hours compared with three days for the traditional serum glass plate agglutination after separation pure culture in clinical detection, the diagnosis time is greatly shortened, and a basis is provided for clinical diagnosis.

The present invention relates to reagent kit and process for detecting Vibrio vulnificus in circular mediate constant temperature amplification method. The reagent kit includes: circular mediate constant temperature amplification reactant liquid A with upstream inner primer tgccactcggctacgataacgtttttgagctgtcacggcagttg, downstream inner primer acgcagacaaaacgctcacagtttttgagcttatcgccttcccaat, upstream outer primer tggttcggttaacggctg and downstream outer primer gccatcaacatagcggctaa; and 1-1.5 M beetaine. The detection process includes the following steps: extracting bacterium DNA, circular mediate constant temperature amplification of Vibrio vulnificus, color developing detection, etc. The present invention has the advantages of high speed, high specificity, high sensitivity and low cost.

The invention relates to a preparation and using method of a yersinia genus rapid detection kit. The kit includes loop-mediated isothermal amplification reaction liquid A, BstDNA polymerase B and chromogenic reagent C. The reaction liquid A contains reaction buffer, dNTP, sulfate magnesium, upstream internal primer 5- CCGGTTTGATCGGTTTCGCCCACTTACAAGATGGGTGTGCC-3, downstream internal primer 5- GTGCGTTTCTGGCCGAGCTTGCAGACGTTTTGCCAGGATT-3, upstream external primer 5- CGCCGTGAAGGTAAAGTTCA-3, downstream external primer 5-CAGAGTTCAGGAACGACAGC-3 and betaine. The method for detecting the yersinia genus includes the DNA extraction of a sample to be detected or bacteria, the loop-mediated isothermal amplification and the chromogenic detection of the yersinia genus. The invention has the advantages of rapid property, strong specificity, high sensitivity and low cost.

The invention relates to a method for quickly detecting bacterial DNA. The sample containing bacterial DNA is provided and treated according to a PCR method. The DNA copies which are multiplied by means of PCR are detected.

The invention relates to a rapid detection reagent kit for Enterobacter sakazaii by using a loop-mediated isothermal amplification technology and a detection method thereof. A loop-mediated isothermal amplification reaction liquid, Bst DNA polymerase and a chromogenic reagent are placed in the reagent kit; and the reaction liquid contains a reaction buffer liquid, dNTP, magnesium sulfate, an upstream inner primer 5- TATGCGGGATCGAACCGCAGA-GGCTATAGCTCAGCTGGGA-3, a downstream inner primer 5- GCTCCACCATCACTTCGGAGTG-TTCAGCTTGTTCCGGATTGT-3, an upstream outer primer 5- TCCGCAGGAGTTGAAGAGG-3, a downstream outer primer 5-CAGCAGCGTGTCTGTTTCA-3 and lycine. The method for detecting the Enterobacter sakazaii comprises the extraction of bacterial DNA, the loop-mediated isothermal amplification of the Enterobacter sakazaii, and chromogenic detection. The rapid detection reagent kit and the detection method have the advantages of quickness, strong specificity, high sensitivity and low cost.

The invention relates to a biological detection reagent, in particular to a primer, a kit and a detection method which are used for the fast detection of the loop-mediated isothermal amplification technology of an enterobacter sakazaii. The primer used for the fast detection of the loop-mediated isothermal amplification technology of the enterobacter sakazaii is a set of character primer group of the enterobacter sakazaii; one set of primers consists of two pairs of primers; one pair of primers refers to outer primers and the other pair refers to inner primers; the invention has six sets of primers. The kit comprises a set of primers, a reaction liquid, BstDNA polymerase, a sample pre-processing liquid, a visualization reagent, a masculine contrast liquid; the detection method includes extracting the DNA of the strain, the loop-mediated isothermal amplification reaction and coloration detection. The method has the advantages of fast speed, strong specificity, high sensitivity and low cost. The enterobacter sakazaii in the sample can be fast detected by using the kit to carry out simple processing on the sample; thus having the advantages of high sensitivity, strong specificity, simple operation, and the like; besides, the result can be judged by sight.

The invention provides compounds and salts of Formula I and Formula II:which possess antimicrobial activity. The invention also provides novel synthetic intermediates useful in making compounds of Formula I and Formula II. The variables A1, A8, R2, R3, R5, R6, R7, and R9 are defined herein.Certain compounds of Formula I and Formula II disclosed herein are potent and selective inhibitors of bacterial DNA synthesis and bacterial replication. The invention also provides antimicrobial compositions, including pharmaceutical compositions, containing one or more compounds of Formula I or Formula II and one or more carriers, excipients, or diluents. Such compositions may contain a compound of Formula I or Formula II as the only active agent or may contain a combination of compounds of Formula I and / or Formula II and one or more other active agents. The invention also provides methods for treating microbial and protozoal infections in animals.

This invention provides an aquatic dung bacteria DNA distilling kit and its method. In this invention, the dung is disposed by ethanol and TritonX-100 to increase sensitivity of the bacteria to cracking liquid. Then cell is cracked by cracking liquid with SDS, the liquid also has PVP that with absorption to PCR restrictor. Then a high concentration GuSCN, low pH environment is provided for further denaturation of protein in the solution, and the water solubility is reinforced, and the DNA can be binding on silica gel column. Finally, DNA is eluted from the column in low concentration buffer solution or water. The goal of the maximum diversities information, high quality and higher output DNA of aquatic dung bacteria community can be reached by using this kit and its distilling method. The DNA got can be used to molecular ecology, system evolution and other researches.

The present invention provides systems, devices, apparatuses and methods for automated bioprocessing. Examples of protocols and bioprocessing procedures suitable for the present invention include but are not limited to: immunoprecipitation, chromatin immunoprecipitation, recombinant protein isolation, nucleic acid separation and isolation, protein labeling, separation and isolation, cell separation and isolation, food safety analysis and automatic bead based separation. In some embodiments, the invention provides automated systems, automated devices, automated cartridges and automated methods of western blot processing. Other embodiments include automated systems, automated devices, automated cartridges and automated methods for separation, preparation and purification of nucleic acids, such as DNA or RNA or fragments thereof, including plasmid DNA, genomic DNA, bacterial DNA, viral DNA and any other DNA, and for automated systems, automated devices, automated cartridges and automated methods for processing, separation and purification of proteins, peptides and the like.

This invention provides an aquatic dung bacteria DNA distilling kit and its method. In this invention, the dung is disposed by ethanol and TritonX-100 to increase sensitivity of the bacteria to cracking liquid. Then cell is cracked by cracking liquid with SDS, the liquid also has PVP that with absorption to PCR restrictor. Then a high concentration GuSCN, low pH environment is provided for further denaturation of protein in the solution, and the water solubility is reinforced, and the DNA can be binding on silica gel column. Finally, DNA is eluted from the column in low concentration buffer solution or water. The goal of the maximum diversities information, high quality and higher output DNA of aquatic dung bacteria community can be reached by using this kit and its distilling method. The DNA got can be used to molecular ecology, system evolution and other researches.