Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, reagent kit and detection method for enterobacter sakazakii hymenial veil mediated isothermality amplification technique fast detection

A technology of Enterobacter sakazakii and loop-mediated isotherm, applied in biochemical equipment and methods, recombinant DNA technology, microbial determination/testing, etc., can solve the problem of inconvenient, poor specificity, and low sensitivity detection methods of Enterobacter sakazakii and other problems, to achieve the effect of simple identification, high sensitivity, and efficient amplification

Active Publication Date: 2009-02-18
CHINA JILIANG UNIV
View PDF8 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In order to solve the technical defects of the existing detection method of Enterobacter sakazakii (Enterobacter sakazakii) inconvenient, low sensitivity, long time, poor specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, reagent kit and detection method for enterobacter sakazakii hymenial veil mediated isothermality amplification technique fast detection
  • Primer, reagent kit and detection method for enterobacter sakazakii hymenial veil mediated isothermality amplification technique fast detection
  • Primer, reagent kit and detection method for enterobacter sakazakii hymenial veil mediated isothermality amplification technique fast detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] The preparation of embodiment 1 kit

[0058] The genetic diagnosis kit provided by the present invention is composed of a set of primers, which includes two pairs of primers, Bst DNA polymerase, reaction solution, sample pretreatment solution, chromogen and positive control solution.

[0059] (1) There are 6 sets of primer sets, which are:

[0060] Primer set one:

[0061] Outer primer 1: GCAATATTCCCCACTGCTGC

[0062] Outer primer 2: GGAGGGGGATAACTACTGGA

[0063] Inner primer 1: CGACGATCCCTAGCTGGTCTGATTTTTCTGGACCGTGTCTCAGTT

[0064] Inner primer 2: TCCCATCTGGGCACATCTGATGTTTTAACGTCTACGGACCAAAGTG

[0065] or primer set two:

[0066] Outer primer 1: AGTGTGGCTGGTCATCCT

[0067] Outer primer 2: CGGACGGGTGAGTAATGTCT

[0068] Inner primer 1: GCCATCAGATGTGCCCAGATGGTTTTTCTCAGACCAGCTAGGGATCG

[0069] Inner primer 2: AGGTCCCCCACTTTGGTCCCGTATTTTGGAAACTGCCTGATGGAGG

[0070] or primer set three:

[0071] Outer primer 1: TGTGGCTGGTCATCCTCTC

[0072] Outer primer 2: TGCTGCTC...

Embodiment 2

[0096] Embodiment 2 detection method

[0097] Tested sample: put a little food or body fluid and other tested samples in the enrichment solution and incubate at 37°C.

[0098] (1) Pretreatment of the sample to be tested: Extract the DNA gene according to the conventional method:

[0099] A. Take 50ul of overnight culture enrichment solution in an eppendorf tube, centrifuge at 1000rpm for 2 minutes, and discard the supernatant;

[0100]B. Add 80ul sample pretreatment solution to the centrifuge tube, and mix evenly with the bacteria obtained from the precipitation;

[0101] C. Boil in boiling water for 10 minutes and then cool immediately for 10 minutes;

[0102] D. Centrifuge at 10,000 rpm for 2 minutes, and the supernatant can be used as template DNA to be used.

[0103] (2) The reaction process of the loop-mediated isothermal amplification technology:

[0104] A. Prepare reaction system in 200ul PCR tube: primer mixture 2.5ul, reaction solution 5.0ul, Bstpolymerase Large ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a biological detection reagent, in particular to a primer, a kit and a detection method which are used for the fast detection of the loop-mediated isothermal amplification technology of an enterobacter sakazaii. The primer used for the fast detection of the loop-mediated isothermal amplification technology of the enterobacter sakazaii is a set of character primer group of the enterobacter sakazaii; one set of primers consists of two pairs of primers; one pair of primers refers to outer primers and the other pair refers to inner primers; the invention has six sets of primers. The kit comprises a set of primers, a reaction liquid, BstDNA polymerase, a sample pre-processing liquid, a visualization reagent, a masculine contrast liquid; the detection method includes extracting the DNA of the strain, the loop-mediated isothermal amplification reaction and coloration detection. The method has the advantages of fast speed, strong specificity, high sensitivity and low cost. The enterobacter sakazaii in the sample can be fast detected by using the kit to carry out simple processing on the sample; thus having the advantages of high sensitivity, strong specificity, simple operation, and the like; besides, the result can be judged by sight.

Description

technical field [0001] The invention relates to biological detection reagents, in particular to a primer, a kit and a detection method for rapid detection of Enterobacter sakazakii loop-mediated isothermal amplification technology. Background technique [0002] Enterobacter sakazakii (Enterobacter sakazakii), also known as Enterobacter cloacae yellow, is a Gram-negative bacterium of the Enterobacter genus. It was renamed Enterobacter sakazakii after 1980. A pathogenic bacterium newly discovered in recent years that has attracted widespread attention can cause infantile and adult diseases including infantile meningitis, sepsis, sepsis and enterocolitis, etc., and may cause neurological disorders, resulting in serious sequelae and even death. From 2002 to 2003, a well-known milk powder manufacturer in the United States voluntarily recalled infant formula milk powder containing Enterobacter sakazakii. Since then, Enterobacter sakazakii in milk powder has become the focus of wo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/10C12N15/11
CPCY02A50/30
Inventor 张明洲陈宗伦方美明刘军傅小伟胡华军
Owner CHINA JILIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products