Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation and detection method of Bacterium typhosum rapid detection reagent kit

A technology of Salmonella typhi and detection kit, which is applied in biochemical equipment and methods, determination/inspection of microorganisms, resistance to vector-borne diseases, etc., can solve the problems of high detection sensitivity and long time required, and achieve high sensitivity , a strong specific effect

Inactive Publication Date: 2008-09-03
INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

People have made unremitting efforts in the process of exploring Salmonella detection methods. The existing detection methods mainly include: 1. Isotope labeling. This method uses isotope-labeled Salmonella typhi DNA fragments. The sensitivity is high, but it takes a long time. At present, there is no report on the kit and detection method for the detection of Salmonella typhi by the loop-mediated isothermal amplification method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Prepare the Loop-Mediated Isothermal Amplification Kit for Salmonella Typhi according to the following recipe:

[0034] (1) Preparation of LAMP reaction solution:

[0035] Contains 2.5 μL 10× Thermopol reaction buffer, 1.0 μL 10 mmol / L dNTP, 1.0 μL 20 μmol / L upstream internal primer (FIP), 1.0 μL 20 μmol / L downstream internal primer (BIP), 0.25 μL 20 μmol / L upstream external primer ( F3), 0.25 μL 20 μmol / L downstream outer primer (B3), 0.5 μL 100 mmol / LMgSO 4 , 12.5 μL 2mol / L betaine and 4 μL ddH 2 O.

[0036] The upstream internal primers described therein:

[0037] 5-TTACGTCACCAACGACACGGG-ACGTATTGGGCAATGACTGG-3,

[0038] Downstream inner primer: 5-CGGTAAATACCATCCCCACGGC-TAACGCAGCGAGAATGGC-3,

[0039] Upstream outer primer: 5-GTCGCGTACTTTACGCCAT-3,

[0040] Downstream outer primer: 5-ACCCTGACCATCCACCAG-3;

[0041] The mass ratio of the four deoxyribose nucleic acids in the mixture dNTP is dUTP:dATP:dGTP:dCTP=2:1:1:1.

[0042] (2) UNG enzyme: 1U / μL;

[0043](3)...

Embodiment 2

[0057] Prepare the Loop-Mediated Isothermal Amplification Kit for Salmonella Typhi according to the following recipe:

[0058] (1) Preparation of LAMP reaction solution:

[0059] Contains 2.5 μL 10× Thermopol reaction buffer, 1.0 μL 10 mmol / L dNTP, 1.0 μL 20 μmol / L upstream internal primer (FIP), 1.0 μL 20 μmol / L downstream internal primer (BIP), 0.25 μL 20 μmol / L upstream external primer ( F3), 0.25 μL 20 μmol / L downstream outer primer (B3), 0.5 μL 100 mmol / L MgSO 4 , 12.5 μL 2mol / L betaine and 4 μL ddH 2 O.

[0060] The upstream internal primer, downstream internal primer, upstream external primer, and downstream external primer are the same as above. The mass ratio of the four deoxyribose nucleic acids in the above mixture dNTP is dUTP:dATP:dGTP:dCTP=2:1:1:1.

[0061] (2) UNG enzyme: 1U / μL;

[0062] (3) Bst DNA polymerase: 8U / μL;

[0063] (4) Chromogen: 10% fluorescent dye SYBR GREEN I or DNAGreen.

[0064] Follow the procedures (1)-(3) below for testing:

[0065] (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for fast detecting bacteria specimen by loop mediate disothermal amplification technology (LAMP), particularly to a method for preparing a reagent kit for fast detecting salmonella typhosa and a method for detecting Salmonella typhosa. The reagent kit contains loop mediate disothermal amplification reaction liquid, Bst DNA polymerase and developer; the loop mediate disothermal amplification reaction liquid includes reaction buffer liquid, dNTP, bitter salt, upstream inner primer 5- TTACGTCACCAACGAC ACGGGACGTATTGGGCAATGACTGG-3, downstream inner primer 5- CGGTAAATACCATCCCCACGGCT AACGCAGCGAGAATGGC -3, upstream outer primer 5- GTCGCGTACTTTACGCCAT-3, downstream outer primer 5- ACCCTGACCATCCACCAG -3 and lycine; the method for detecting Salmonella typhosa comprises the steps of extracting bacterial DNA, loop mediate disothermal amplifying of the salmonella typhosa, and development detecting. The invention has the following advantages, including high speed, strong specificity, high sensitivity and low cost.

Description

technical field [0001] The invention relates to a method for rapid detection of bacterial samples using a loop-mediated isothermal amplification (LAMP) technology, in particular to a preparation and detection method of a rapid detection kit for Salmonella typhi. Background technique [0002] Salmonella enterica is a kind of non-spore-forming Gram-negative bacilli with a size of 0.6~1.0×2~3um. It is a genus of pathogenic intestinal bacteria, including typhoid bacteria, which generally have flagella and no capsule Most of them have pili, which are very similar to E. coli in shape and physiology. In 1885, Salmonella and others isolated Salmonella choleraesuis during the epidemic of cholera, so it was named Salmonella. Some Salmonella are pathogenic to humans, some are only pathogenic to animals, and some are pathogenic to both humans and animals. Salmonellosis is a general term for different forms of humans, domestic animals and wild animals caused by various types of Salmonel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/10C12Q1/68
CPCY02A50/30
Inventor 梁成珠高宏伟贾俊涛林超
Owner INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More