Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila

The technology of Aeromonas hydrophila and detection kit is applied in the field of detection of target DNA fragments, and can solve the problems of numerous detection steps for pathogenic Aeromonas hydrophila, difficult to grasp the accuracy, time-consuming data processing and the like, To achieve the effect of reducing background influence, method convenience, and enhancing specificity

Active Publication Date: 2011-08-03
ZHEJIANG INST OF FRESH WATER FISHERIES
View PDF1 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention aims to solve the problems of numerous detection steps of pathogenic Aeromonas hydrophila, cumbersome operation, time-consuming processing of detected data and difficulty in grasping the accuracy, and provides LAMP detection of pathogenic Aeromonas hydrophila Kits and Assays

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila
  • LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila
  • LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0052] The present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments.

[0053] 1) DNA extraction

[0054] Pick suspected colonies and add them to 0.4mL TE buffer (pH8.0) for shaking and mixing. Add 100 μL of lysozyme solution, incubate at 37°C for 10 minutes, add 10 μL of proteinase K solution, incubate at 55°C for 1-2 hours, add the same volume of Tris saturated phenol (pH8.0), shake vigorously, centrifuge at 11000g for 3 minutes, and take the supernatant solution, and repeated phenol extraction; take the supernatant, add 0.1 times the volume of sodium acetate (3mol / L), mix well, add an equal volume of ice ethanol, mix well, let stand at low temperature for 30 minutes, and centrifuge at 15000g for 5 minutes. Discard the supernatant, wash once with 70% cold ethanol, centrifuge at 15,000 g for 5 minutes at room temperature, discard the supernatant, add 50 μL TE solution to obtain a genomic DNA solution to be teste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an LAMP (Loop-mediated Isothermal Amplification) detection kit of pathogenic aeromonas hydrophila, having convenient use and rapid detection. The LAMP detection kit comprises a bacterium DNA extracting reagent and an LAMP reaction reagent, wherein the reaction reagent contains primers FIP with the sequence of GTTTCCCCCATCAGATCCGTGGTTTACGCCACCCAGTTTCTTG, BIP with the sequence of TCCGGCCTGTATACCTGTATCAGGTTAAACCAGGGTGTCATCGCT, F3 with the sequence of TGATGGCCACGAGACATCCA and B3 with the sequence of TGCTTGATCCCCTTGCTACT. The LAMP detection method of the pathogenic aeromonas hydrophila comprises the following steps of: (1) DNA (Deoxyribonucleic Acid) extraction; (2) LAMP amplification of the pathogenic aeromonas hydrophila; and (3) staining detection. The invention is suitable for detecting the pathogenic aeromonas hydrophila.

Description

technical field [0001] The invention relates to a detection technology of a target DNA fragment, in particular to a kit and a detection method for rapid detection of pathogenic Aeromonas hydrophila by using a loop-mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP) technology. Background technique [0002] Aeromonas hydrophila (Aeromona hydrophila) is an opportunistic pathogenic bacterium that widely exists in water and soil, and can cause systemic sepsis or Local infection often leads to a large number of animal deaths, and can also cause human sepsis, meningitis and enteritis diarrhea. Aeromonas hydrophila is an acute infectious disease pathogen that harms the most species of fish in the history of fish farming in my country, the most widespread area, the longest epidemic season, the most types of fish farming waters, and the most serious losses. Since it became popular across the country in the 1990s, many aquaculture animals can be infected ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 潘晓艺沈锦玉郝贵杰姚嘉赟徐洋尹文林
Owner ZHEJIANG INST OF FRESH WATER FISHERIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com