Eel aeromonas hydrophila and edwardsiella tarda bigeminal recombinant protein and preparation method thereof
A technology of Aeromonas hydrophila and recombinant protein, which is applied in the direction of chemical instruments and methods, biochemical equipment and methods, recombinant DNA technology, etc., can solve the problems of large damage to fish body and cumbersome operation, and reduce the damage of fish body. Damage, Simplified Immunity Steps, Good Immunity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] In this example, the dual recombinant protein of Aeromonas hydrophila and Edwardsiella tarda of the present invention was carried out. Preparation of (OMP-Arom-Edwa)
[0041] (1) Use the following specific primers to amplify the nucleotide sequence of the outer portion of the type II porin of Aeromonas hydrophila: forward primer B11F:
[0042] 5'tcgggcggtggcggctcgggtggcggatcatccggtatcgccaagactgaatg3' (SEQ ID NO3) and reverse primer B11R: 5'CCGGAATTCctggatcttgtactcggtgtaggc3' (SEQ ID NO4), where B11F includes the linker region (tcgggcggtggcggctcgggtggcggatca), and B11R includes the base cleavage site of ECC and EcoR The nucleotide sequence of the extramembrane portion of ompS2 of Edwardsiella tarda was amplified with the following specific primers: forward primer B79F:
[0043] CGCGGATCCgccggcctgaagtatggcaa (SEQ ID NO5) and reverse primer B79R: acccgagccaccaccgcccgagcctataagcacgggtgaagtcattctcatc (SEQ ID NO6), wherein B79F includes a BamH I restriction site and a protec...
Embodiment 2
[0062] (1) PBS blank control, double inactivated bacterial liquid of Aeromonas hydrophila and Edwardsiella tarda, and the dual recombinant protein of Aeromonas hydrophila and Edwardsiella tarda of the present invention obtained in Example 1 Three groups of eels were immunized by intraperitoneal injection, and each group of eels corresponded to the PBS control group 1, the double inactivated bacteria immunization group 2 and the double-expressed outer membrane protein immunization group 3, wherein the eel hydrophile of the present invention Bacillus and Edwardsiella tarda double recombinant protein was prepared with 0.01M PBS (pH=7.4) to make 1mg / mL before the test, and it was fully mixed with the same amount of Freund's incomplete adjuvant, and the final concentration was 0.5 mg / mL; Aeromonas hydrophila and Edwardsiella tarda were cultured in tryptone soy broth (TSB) at 28°C and 32°C for 24h, respectively, and mixed with 0.01M PBS (pH=7.4) to prepare 5.0× 10 8 cfu / mL bacteria...
Embodiment 3
[0065] (1) Same as embodiment 2;
[0066] (2) After the above three groups of eels were immunized, the serum was collected for ELISA detection of eel serum-specific antibody titer (according to Guo SL, Chen NH, Guan RZ, Feng JJ, Huang WS.2006. Effects of Anti-Bursin Monoclonal Antibody on Immunosuppression in the duck (Cherry Valley duck). Poult Sci, 2006; 85:258-65. carry out), such as image 3 As shown, the antibody levels of the double-inactivated bacteria immunization group 2 and the double-expressed outer membrane protein immunization group 3 were significantly (P<0.01) and significantly (P<0.05) higher than those of the PBS control group 1 on the 14th day and 21st day, respectively. On the 28th day, the antibody level of the double-expressed outer membrane protein immunization group 3 was significantly (P<0.01) higher than that of the PBS control group 1, while the double-inactivated bacteria immunization group 2 was significantly (P<0.05) higher than that of the PBS con...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com