57results about How to "Potential for clinical application" patented technology

An immunostimulatory oligonucleotide that is represented by the general formula 5′-Gm-GACGATCGTC-Gn-3′ or 5′-Gm-CACGATCGTG-Gn-3′ (in the formula, m and n are each independently an integer from 1 to 9 and m+n=10) and that comprises any of the following base sequences: GGACGATCGTCGGGGGGGGG (SEQ. ID. NO.: 1), GGGACGATCGTCGGGGGGGG (SEQ. ID. NO.: 2), GGGGACGATCGTCGGGGGGG (SEQ. ID. NO.: 3), GGGGGGGACGATCGTCGGGG (SEQ ID NO: 4), GGGGGGGGACGATCGTCGGG (SEQ. ID. NO.: 5), GGGGGGGGGACGATCGTCGG (SEQ. ID. NO.: 6), GGGGGGGGGGACGATCGTCG (SEQ. ID. NO.: 7), and GGGGGGGGGCACGATCGTGG (SEQ. ID. NO.: 8).

The invention discloses a tetradecyl sodium sulfate injection and a preparation method thereof. Sodium tetradecyl sulfate injection of the present invention, its raw material formula comprises following components: disodium hydrogen phosphate, sodium tetradecyl sulfate, benzyl alcohol, water and pH adjusting agent; Said sodium tetradecyl sulfate injection The pH of the liquid=7.5~7.9. The preparation method of sodium tetradecyl sulfate injection of the present invention comprises the following steps: mixing the aqueous solution of disodium hydrogen phosphate with pH=8.4 to 8.8 and the mixed solution of benzyl alcohol with the tetradecyl sodium Alkyl sodium sulfate is mixed evenly, and the pH regulator is added to make the pH of the mixed system to 7.5-7.9. The sodium tetradecyl sulfate injection of the invention has good stability, high content of active ingredients, meets the requirements of pharmacopoeia standards, and has the potential of clinical application.

The invention discloses benzophenone derivatives derived from marine fungi, a preparation method of the benzophenone derivatives and application of the benzophenone derivatives in the preparation of antituberculosis drugs. The structural formulae of the benzophenone derivatives are represented by a formula I or II. The compounds have the activities of remarkably inhibiting protein tyrosine phosphatase secreted by mycobacterium tuberculosis and can be used for preparing the antituberculosis drugs, and IC50 of the compounds are respectively 5.2mM(I) and 4.2mM(II). Therefore, the benzophenone derivatives derived from marine fungi have the clinical application potential in the treatment of tuberculosis.

The invention discloses isobenzazole compounds derived from marine fungi, a preparation method of the isobenzazole compounds and application of the isobenzazole compounds in the preparation of anti-inflammatory drugs. The structural formulae of the isobenzazole new compounds are represented by a formula I, II, III or IV. The new compounds are capable of remarkably inhibiting the generation of LPS-induced NO and can be used for preparing the anti-inflammatory drugs, and the IC50 of the compounds are respectively 8.9mM(I), 12.4mM(II), 18.2mM(III) and 22.7mM(IV). Therefore, the isobenzazole compounds have the clinical application potential in the anti-inflammatory treatment.

The invention discloses a polydopamine nanometer diagnosis and treatment preparation and a preparation method thereof. The nano-therapeutic agent uses mesoporous polydopamine as a carrier, and carries rhodium nanoparticles in the pores and surfaces of mesoporous polydopamine respectively through hydrothermal synthesis reaction, and then absorbs photosensitizer chlorin (Ce6) on polydopamine and polydopamine. The polydopamine nanometer therapeutic agent with good dispersion is obtained on the composite nanoparticle of rhodium. The invention utilizes the photothermal effect of the carrier mesoporous polydopamine and the rhodium nanoparticle itself to locally heat up the tumor site. Combined with the catalytic properties of rhodium nanoparticles, it catalyzes the decomposition of hydrogen peroxide in the tumor microenvironment to generate oxygen. Under the conditions of photosensitizer Ce6 and external laser, it can realize the generation of singlet oxygen and effectively kill cancer cells. At the same time, combined with the photoacoustic imaging properties of polydopamine, the purpose of photoacoustic imaging-guided photothermal therapy and photodynamic synergistic therapy can be realized, which is expected to improve the effect of tumor treatment and has good biocompatibility, which has the potential for clinical application.

The invention discloses a heteroterpene compound derived from a marine fungus and its application in the preparation of anti-inflammatory drugs. The present invention separates the heteroterpenoids from the fermentation product of a marine fungus, Aspergillus terreus GZU-31-1, and its structural formulas are shown in formulas 1-5. These new compounds can significantly inhibit the production of inflammatory factor NO induced by LPS, and the ICs of compounds 1-5 50 They are: 6.74±0.77μmol / L, 22.18±0.94μmol / L, 25.87±3.1μmol / L, 26.47±0.98μmol / L, 29.59±3.9μmol / L, which have clinical application potential for treating and anti-inflammation and can be used for development A new type of anti-inflammatory drug with good application prospect.

The present invention discloses a class of polypeptide compounds targeting PD-1 receptors. The polypeptide compounds include compound 1, compound 2, compound 3, compound 4 and compound 5; wherein, the amino acid sequence of compound 1-5 is as shown in SEQ ID NO : as shown in 1‑5. The invention also discloses a preparation method of a polypeptide compound targeting the PD-1 receptor, including the following process: using solid-phase synthesis, sequentially coupling the amino acids of compound 1-5 to a solid-phase resin according to the peptide sequence Above, the target compound is obtained through cleavage reagent cleavage, freeze-drying, preparation and purification. The invention also discloses the application of a class of polypeptide compounds targeting PD‑1 receptors in the preparation of analgesic drugs. The small molecule polypeptide of the present invention: compounds 1-5 can bind to PD-1, and have significant inhibitory effects on inflammatory pain and visceral pain under intrathecal administration; and the synthesis is simple, easy to purify, and facilitates large-scale synthesis.