70 results about "Vinblastine" patented technology

Conjugates of transferrin, albumin and polyethylence glycol consisting of native or thiolated transferrin or albumin or of polyethylene glycol (MW between approximately 5,000 and 20,0000) with at least one HS-, HO- or H2N group and cytostatic compounds derived through maleinimide or N-hydroxysuccinimide ester compounds, such as doxorubicin, daunorubicin, epirubicin, idarubicin, mitoxandrone, chloroambucil, melphalan, 5-fluorouracyl, 5'-desoxy-5-fluorouridine, thioguanine, methotrexate, paclitaxel, docetaxel, topotecan, 9-aminocamptothecin, etoposide, teniposide, mitopodoside, vinblastine, vincristine, vindesine, vinorelbine or a compound of general formula A, B, C or D, where n=0-6, X=-NH2, -OH, -COOH, -O-CO-R-COR*, -NH-CO-R-COR*, where R is an aliphatic carbon chain with 1-6 carbon atoms or a substituted or unsubstituted phenylene group and R* H, phenyl, alkyl with 1-6 carbon atoms.

The invention belongs to the field of pharmaceutical compounds, and relates to a new vinblastine derivative, a preparation method of the vinblastine derivative, a pharmaceutical composition containing the derivative, and application of the vinblastine derivative as a therapeutic agent. The vinblastine derivative provided by the invention is a compound shown in a general formula (I) or salt thereof. The compound provided by the invention or salt thereof can be used as a pharmaceutical ingredient for inhibiting the cell proliferation of mammals or preparing a pharmaceutical composition for treating tumors so as to treat the solid tumor, cancer, lymphoma, Hodgkin's disease, tumor disease, neoplastic disease and the like of mammals.

A method of increasing the desacetyl vinblastine content in Vinca rosea, removing foreign matter from fresh Vinca rosea, feeding into culture solution and inducer for fresh homogenate culture for 24-60 hours, the desacetyl vinblastine content in Vinca rosea in the culture solution and solid material is increased by 45-70% through HPLC detection and the leurocristine content is also increased. The method is characterized by the short producing period, easy-to-operate process and suitable for industrial production.

The invention provides a vinblastine derivative of the formula at right or relative physiological acceptable salt, a relative preparation method, an application and a drug compound of the derivative, wherein the vinblastine derivative has inhibitory activity on tumor cell lines, which can be used as drug for treating malignant tumor.

The present disclosure relates to a series of bis(hydroxymethyl) and its bis(carbamate) of 8H-3a-azacyclopenta[a]indene-1-yl and 5,10-dihydropyrrolo-[1,2-b]isoquinolines derivatives (Formula I-Formula IV) as DNA di-alkylating agents. The preliminary antitumor studies indicated that compounds disclosed herein could exhibit potent cytotoxicity in vitro and antitumor therapeutic efficacy in human tumor xenografts and could have little or no cross-resistance to either Taxol or Vinblastine. The results demonstrated that compounds disclosed herein possess potent antitumor therapeutic efficacy and are expected to have potential for clinical applications.

This invention discloses a vinblastine molecular imprinted polymer, which has the imprinting sites of the template molecule vinblastine. The vinblastine molecular imprinted polymer is prepared by heat-initiated polymerization of vinblastine 1 part, functional monomer 3-10 parts, crosslinker 10-50 parts and appropriate pore-forming agent at 40-80 deg.C. The obtained vinblastine molecular imprinted polymer has unique affinity, high selectivity and excellent molecular reorganization to vinblastine, and can be used as separation filler for extracting, separating and enriching vinblastine from natural plants and biological samples.

A therapeutic approach to prevent drug resistance and chemotherapy-related secondary cancer associated with DNA mismatch repair (MMR) deficiency is disclosed based on screening antioxidants for reducing microsatellite instability (MSI) while enhancing the cytotoxicity of chemotherapeutic agents. The work is based on experiments using antioxidants to target reactive oxygen species generated by oxaliplatin, a commonly used chemotherapeutic agent, and is applicable to other chemotherapeutic agent, and in particular 5-fluorouracil, methotrexate, CCNU, etoposide and vinblastine. In particular oxaliplatin is co-treated with an antioxidant, including CDC, CAPE, ciclopirox ethanolamine, hinokitiol, gossypol, n-Octyl caffeate, baicalein, or curcumin.

New uses for phenylketone carboxylate compounds and substituted aromatic compounds of Formula I, Formula I.1, Formula I.2, Formula IA, Formula IB, Formula IC and Formula II and their pharmaceutical acceptable salts for the treatment of cancer. The use of a combination of two of these compounds is described and the use of the combination of one of these compounds with an anticancer agent such as decarbazine, doxorubicin, daunorubicin, cyclophosphamide, busulfex, busulfan, vinblastine, vincristine, bleomycin, etoposide, topotecan, irinotecan, taxotere, taxol, 5-fluorouracil, methotrexate, gemcitabine, cisplatin, carboplatin and chlorambucil.

The invention discloses a method for producing vinblastine and / or vincristine. The method comprises: inoculating a periwinkle polyploid cell strain in a synthetic medium, and obtaining a cell rich in vinblastine and vincristine by cultivating the strain for 3 to 7 days at the temperature between 20 and 29DEG C; and the synthetic medium is a liquid culture medium obtained by adding 0 to 5mg / L of plant cell auxin, 0 to 5mg / L of plant cytokinin, 30 to 60g / L of sucrose, 1 to 50mu g / L of acetyl coenzyme A, 10 to 40mu g / L of hydogen peroxide, 0.1 to 2mu mol / L of Benzotriazole methl, 10 to 150mg / L of tryptophan, 10 to 110mg / L of loganin and 10 to 50mg / L of cerium chloride in a minimal medium. The method using periwinkle cells to cultivate and produce vinblastine and vincristine can stably realize the industrialized production of vinblastine and vincristine, and the production cost is rather low, the culture period is short, and the production is insusceptible to the natural environment and weather, so the year-round production can be realized.

The invention relates to a process for preparing vinblastine, which has simple and convenient operation and less pollution and equipment investment. The process comprises the following steps: soakingthe whole catharanthus roseus by 8-12 times of acetic acid aqueous solution with concentration of 5-20 percent for 2 hours; assisting to extract by a microwave with the extracting power of 600W and the extracting time of 2-8 minutes; filtering and adjusting the pH value of filter liquor to 8 by ammonia water; adsorbing by a macroporous absorption resin column; eluting and removing impurities by 20-60 percent of alcohol with the pH value being equal to 5; eluting by 95 percent of alcohol; concentrating eluent, adding acetone crystals, washing and drying to obtain the vinblastine. The process for preparing the vinblastine is easy to realize industrialization amplification.

Conjugates of transferrin, albumin and polyethylence glycol consisting of native or thiolated transferrin or albumin or of polyethylene glycol (MW between approximately 5,000 and 20,0000) with at least one HS-, HO- or H2N group and cytostatic compounds derived through maleinimide or N-hydroxysuccinimide ester compounds, such as doxorubicin, daunorubicin, epirubicin, idarubicin, mitoxandrone, chloroambucil, melphalan, 5-fluorouracyl, 5'-desoxy-5-fluorouridine, thioguanine, methotrexate, paclitaxel, docetaxel, topotecan, 9-aminocamptothecin, etoposide, teniposide, mitopodoside, vinblastine, vincristine, vindesine, vinorelbine or a compound of general formula A, B, C or D, where n=0-6, X=-NH2, -OH, -COOH, -O-CO-R-COR*, -NH-CO-R-COR*, where R is an aliphatic carbon chain with 1-6 carbon atoms or a substituted or unsubstituted phenylene group and R*H, phenyl, alkyl with 1-6 carbon atoms.

The invention discloses a process method for preparing vinorelbine, which comprises the following steps: taking dehydration vinblastine or salt thereof as a starting material, obtaining rough vinorelbine after bromoforming and a ring contraction reaction, and obtaining vinorelbine through column chromatography. The method adopts silver nitrate to replace silver boron tetrafluoride to be served as a reduction cyclization reagent, and thereby not influencing the yield of the reaction and the purity of crude products, and further reducing the production cost.

A double sustained release anticancer gel sustained release injection consists of anticancer medicine and amphiphilic block copolymer hydrogel, wherein the anticancer medicine comprises vincristine, vinorelbine, vinblastine, daunomycin, mitoxantrone, mitozolomide and temozolomide, etc., and exists in sustained release preparation injection in the forms of sustained release microsphere, microsphere or micropowder, i.e. the anticancer medicine in anticancer useful quantity is partly or completely wrapped inside the sustained release microsphere. Sustained release gel has temperature-sensitive gelling characteristics and is in the state of fluxible liquid in an environment with the temperature lower than body temperature; moreover, the sustained release gel can be automatically converted into non-flowing water-insoluble gel capable of biodegradation and absorption inside the body of a warm blood so as to slowly release medicine inside part of a tumor; the sustained release microsphere is propitious to release medicine smoothly and slowly, and double sustained release is propitious to control tumor cells entering a dormancy stage; moreover, the medicine which exists in the sustained release gel in the form of micropowder is propitious to release the medicine relatively faster and to control cells in faster proliferation. The double sustained release anticancer gel sustained release injection can used together with radiotherapeutic particle, etc.

Compounds, pharmaceutical compositions including the compounds, and methods of preparation and use thereof are disclosed. The compounds are noscapine analogs. The compounds and compositions can be used to treat and / or prevent a wide variety of cancers, including drug resistant cancers. While the antitussive plant alkaloid, noscapine, binds tubulin, displays anticancer activity, and has a safe pharmacological profile in humans, structure-function analyses pointed to a proton at position 9 of the isoquinoline ring that can be modified without compromising tubulin binding activity. Noscapine analogs with various functional moieties at position 9 on the isoquinoline ring kill human cancer cells resistant to other anti-microtubule agents, such as vincas and taxanes. Representative analogs include the 9-nitro, 9-bromo-, 9-iodo-, and 9-fluoro-noscapines, which bind tubulin and induce apoptosis selectively in tumor cells (ovarian and T-cell lymphoma) resistant to paclitaxel, vinblastine and teniposide. Surprisingly, treatment with one of the analogs, 9-nitro-nos, at doses as high as 100 μM, did not affect the cell cycle profile of normal human fibroblasts. This selectivity for cancer cells represents a unique edge over the other available antimitotics. The compounds can perturb the progression of cell cycle by mitotic arrest, followed by apoptotic cell death associated with increased caspase-3 activation and appearance of TUNEL-positive cells. Thus, the compounds are novel therapeutic agents for a variety of cancers, including ovarian and T-cell lymphoma cancers, even those that have become drug-resistant to currently available chemotherapeutic drugs.

Disclosed is a toxic- and side effect-free externally-applied health-care cream for removing wrinkle, caring skin and keeping fitness, wherein the components include alpha-amyin palmitate, serine, vitamin E, praline, vinblastine, lycine, involucratolactone and vitamin B2. The body building and weight reducing components comprise haw lipase, vitamin B12, gamma-leukotriene, vitamin C, mesoinositol, gymnemic acid and m-nitro benzoic acid. The oil phase substance in other components include glycerin monostearate, stearic acid, propylene glycol, glycerin, dimethyl silicon oil, liquid paraffin wax and lanolin. The aqueous phase substance in other components include flavoring agents, non-ionic surface active agent and deionized soft water.

The invention provides a biological seed dressing agent special for cotton, comprising the components according to parts by weight: 11-19 part of propargite, 7-15 parts of a solvent and a co-solvent, 6-14 parts of an emulsifier, 3-5 parts of a stabilizer, 2-4 parts of a synergist, 13-21 parts of water, 2-6 parts of Bergenia purpurascens extract, 1-3 parts of dioctyl divinyltriamino glycine, 1-3 parts of vinblastine, and 1-3 parts of humic acid. The invention also provides a preparation method of the biological seed dressing agent. Therefore, the agent is effective in preventing and treating common diseases in cotton plants, can enhance disease resistance in cotton, can also effectively prevent and treat common pests in cotton planting fields, is high in safety, and has significant effect of increasing cotton yield, with medium to long fiber ratio of cotton significantly increased.

The invention provides a novel application of a vinblastine substance, and specifically speaking, the invention provides an application of vinblastine and its analogue for preventing or treating diabetic retinopathy or rheumatoid arthritis, and especially relates to obvious effect for preventing or treating diabetic retinopathy or rheumatoid arthritis displayed by a vinblastine derivative hydrazinolyed vinblastine compound, vinblastine dipeptides and salt in vitro and vivo, wherein the hydrazinolyed vinblastine compound is the compound obtained by the vinblastine compound and hydrazine hydrate through a reaction; the vinblastine dipeptides can be the hydrazinolyed vinblastine obtained by condensation of compound formed by the vinblastine compound and hydrazine hydrate through the reaction and N-benzyloxycarbonyl dipeptides.

The invention provides a primer, probe and detection kit for determining beta-tubulin III expression. The primers and probes for determining beta-tubulin III gene expression include TUBB3-F TCTACTACAACGAGGCCTCTTCT, TUBB3-R CAAAGATGAAATTGTCAGGCCTGAA, TUBB3-P AGCCACACCAGAATGGCTCGAGGCACGTACCTCG and TUBB3-reverse transcription-TTGCCGGCCCCACTCTGACCAAA. The detection kit can measure the expression level of beta-tubulin III mRNA and provide a method for predicting possible resistance to treatment based on paclitaxels or vinblastines for the subjects.

The invention discloses 2,3,6-trideoxyglycosyl demethylepipodophyllotoxin compound or pharmaceutically acceptable ester thereof. The chemical structural formula of the 2,3,6-trideoxyglycosyl demethylepipodophyllotoxin compound is as shown in the figure I in the specification, wherein R represents C1-C6 alkyl, -OH, -NH2, NO2 and halogen groups. The compound has the advantage of being capable of remarkably improving the cytotoxic activity on human lung cancer cells (A549), human hepatoma cells (HepG2), human cervical cancer cells (HeLa), human neuroblastoma cells (SH-SY5Y) and oral cancer vinblastine-resistant cells (KB-VCR) compared with clinical medication of etoposide and has the potential of being developed into anti-tumor drugs.

The invention relates to a novel method for extracting vincaleukoblastinum from catharanthus roseus. The novel method comprises the following steps: removing impurities in catharanthus roseus, crushing, screening by using a 50-mesh sieve, adding an ethanol solution, adding acid to adjust the PH value to be 2-3, adding a biological enzyme after one hour, performing enzymolysis in a double-frequency ultrasonic device, filtering, adjusting the PH value of the filtrate to be 10.0 by using concentrated ammonia water, extracting with ethyl acetate, collecting an organic phase, drying with anhydrous sodium sulfate, filtering, performing vacuum concentration till the materials are dried, dissolving with a small amount of ethanol, and purifying in a silica gel column chromatography manner, thereby obtaining the high-purity vincaleukoblastinum. The novel method has the advantages of simple process, high extraction rate and high product purity, and is applicable to industrialization production.

The invention relates to a temperature-sensitive liposome preparation of vinblastine medicaments and a preparation method thereof. The temperature-sensitive liposome preparation includes vinblastine medicament, temperature-sensitive phosphatide and optional long circulating material. A molar ratio of temperature-sensitive phosphatide to optional long circulating material is 70:30-92:8; and a weight ratio of vinblastine medicament to blank liposome is 1:10-1:50. The invention employs a pH gradient active drug loading method to reach an entrapment rate of 90.0-99%. The liposome preparation with heat sensitivity of the present invention can make the liposome to passively target a tumour position and release a lot of medicament simultaneously, so as to improve curative effect and reduce toxic and side effects on the whole body.

The invention discloses a wood preservative containing a compound MannolideA. The weight part ratio of MannolideA to vinblastine is (1:1)-(30:1). The invention discovers that matching the MannolideA and the vinblastine according to a specific ratio achieves a favorable wood preservation effect; and especially when the weight part ratio of the MannolideA to the vinblastine is (23-25):1, the synergic preservation effect is very obvious.

A method of treating a hyperproliferative disorder, including a cancer, in a subject in need of such treatment, comprising administering to said subject a pharmaceutical combination containing a treatment effective amount of: (a) a vitamin A derivative (i.e., a retinoid), or a pharmaceutically acceptable salt thereof, and an inhibitor of microtubule structure or function; or (b) a combination containing fenretinide (i.e., N-(4-hydrophenyl) retinamide, 4-HPR) and ABT-751 (i.e., N-[2-[(4-hydroxyphenyl)amino]-3-pyridinyl]-4-methoxybenzenesulfonamide). Vitamin A derivatives that may be useful for this invention according to (a) include, but are not limited to, all-trans-retinoic acid, 13-cis-retinoic acid, and fenretinide. Microtubule inhibitors that may be useful for this invention according to (a) include, but are not limited to, inhibitors of the Vinca binding domain (e.g., vincristine, vinblastine, vinorelbine, and cryptophycin 52), inhibitors of the Taxane domain (e.g., paclitaxel, docetaxel, and epothilones), and inhibitors of the colchicine site (e.g., colchicine, ABT-751, CI-980, and combretastatin). A preferred retinoid according to (a) is fenretinide. A preferred microtubule inhibitor according to (b) is ABT-751.

9-aminonoscapine, prodrugs thereof, and pharmaceutically acceptable salts thereof, are disclosed. Pharmaceutical compositions including 9-aminonoscapine, and methods of preparation and use thereof are disclosed. 9-aminonoscapine is a noscapine analog that can be used to treat and / or prevent a wide variety of cancers, including drug resistant cancers, by binding tubulin and inducing apoptosis selectively in tumor cells (ovarian and T-cell lymphoma) resistant to paclitaxel, vinblastine and teniposide. 9-aminonoscapine can perturb the progression of cell cycle by mitotic arrest, followed by apoptotic cell death associated with increased caspase-3 activation and appearance of TUNEL-positive cells. Thus, 9-aminonoscapine is a novel therapeutic agents for a variety of cancers, including ovarian and T-cell lymphoma cancers, even those that have become drug-resistant to currently available chemotherapeutic drugs.

The invention provides a copolymer which can be used as a carrier of anti-metabolism drugs and tecans, tinibs, vinblastine, camptothecin, paclitaxel, platinum, mycin and hormone antitumor drugs, and segmented copolymer micelles are formed. The solubility of the antitumor drugs is greatly increased, the curative effect is improved, moreover, the in-vivo cycling time of the drugs is extended, the pharmaceutical activity is improved, the burst release effect is reduced, and the bioavailability is increased.

9-Chloro-nos, prodrugs thereof, and pharmaceutically acceptable salts thereof, are disclosed. Pharmaceutical compositions including 9-chloro-nos, and methods of preparation and use thereof are disclosed. 9-Chloro-nos is a noscapine analog that can be used to treat and / or prevent a wide variety of cancers, including drug resistant cancers, by binding tubulin and inducing apoptosis selectively in tumor cells (ovarian and T-cell lymphoma) resistant to paclitaxel, vinblastine and teniposide. 9-Chloro-nos can perturb the progression of cell cycle by mitotic arrest, followed by apoptotic cell death associated with increased caspase-3 activation and appearance of TUNEL-positive cells. Thus, 9-chloro-nos is a novel therapeutic agents for a variety of cancers, including ovarian and T-cell lymphoma cancers, even those that have become drug-resistant to currently available chemotherapeutic drugs.

The invention provides application of vinblastine III in preparing a medicine for preventing or treating Alzheimer's disease. Study found that vinblastine III (CNP) can increase the ADAM10 gene transcription and increase the expression of ADAM10 through an NF-YB way; and meanwhile, the expression of BACE1 is decreased to enable the metabolism of APP to tend to be non-amyloid way. Animal experiments show that CNP can significantly improve the spatial learning and memory abilities and hippocampal-dependent learning and memory abilities of AD model mice, so that a new idea is provided for the development of medicines for preventing or treating neurological diseases such as Alzheimer's disease.

The invention discloses a refreshing and brain strengthening beverage and a preparation method. The beverage consists of the following substances in parts by mass: 100-400 parts of ginseng extract containing 2-7 percent of ginseng total saponin, 30-250 parts containing 0.1-1 percent of vinblastine, 1-2 parts of vitamin B1, 1-2 parts of vitamin B2, 1-2 parts of vitamin B6, 10-30 parts of vitamin C, 3-10 parts of vitamin E, 3,000-10,000 parts of nano soybean meal with particle diameter distributed in a range of 70-800 nm and 8,000,000-11,000,000 parts of drinking water. The method comprises thefollowing steps of: dissolving the ginseng extract in the drinking water to obtain solution A; dissolving the vinblastine in the drinking water to obtain solution B; dissolving vitamin B1, vitamin B2, vitamin B6 and vitamin C in the drinking water to obtain solution C; dissolving the vitamin E in the drinking water of 80 DEG C to obtain solution D; dissolving the nano soybean meal in the drinkingwater; adding the solution C, the solution D, the solution A and the solution B at an interval of 5-20 minutes in sequence; stirring for 0.5-12 hour(s); heating to 80 DEG C and preserving heat for 1-5 minute(s); adding the drinking water and uniformly mixing; and sterilizing and then performing sterile filling. In the invention, each active constituent is adsorbed to the nano soybean meal and is not easily influenced by external environment conditions; and the stability is greatly improved.