Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

39 results about "Burkholderia lata" patented technology

Burkholderia lata is a bacterium from the genus of Burkholderia and the family of Burkholderiaceae which belongs to the Burkholderia cepacia complex.

Application of enzyme FadD1 in pseudomonas aeruginosa for degrading DSF family signal molecules

The invention discloses application of an enzyme FadD1 in pseudomonas aeruginosa for degrading DSF family signal molecules. The enzyme FadD1 capable of degrading DSF family signal molecules produced by thalli in vitro is obtained from the pseudomonas aeruginosa, and has an amino acid sequence shown as SEQ ID NO: 2. The enzyme FadD1 disclosed by the invention is capable of degrading the DSF familysignal molecules outside the thalli, including signal molecules DSF of xanthomonas campestris and quorum sensing signaling BDSF in burkholderia cepacia. Therefore, the enzyme FadD1 can be used for preparing a preparation capable of degrading the DSF family signal molecules in vitro, so as to be applied to controlling plant or animal diseases caused by pathogenic bacteria taking the DSF or BDSF asthe quorum sensing signaling, particularly plant black rot caused by xanthomonas campestris and diseases caused by burkholderia cepacia.
Owner:SOUTH CHINA AGRI UNIV

Method for improving yield of biodiesel prepared through kitchen grease enzymic method through pretreatment

The invention belongs to the technical field of kitchen waste treatment and particularly discloses a method for improving the yield of biodiesel prepared through a kitchen grease enzymic method through pretreatment. The method includes the following steps that firstly, impurities in kitchen waste are removed, and microwave treatment, ultrasonic wave treatment and hydro-thermal treatment is conducted on the kitchen waste in sequence; secondly, three-phase separation is conducted, and upper-layer grease is obtained; thirdly, oxidation is conducted by leading ozone in; fourthly, immobilized composite lipase is added into grease obtained in the third step, and short chain alcohol is added for conducting a transesterification reaction to prepare the biodiesel, wherein the immobilized composite lipase in the forth step comprises geotrichum candidum lipase, candida lipase and burkholderia cepacia lipase. According to the method, microwave treatment, ultrasonic wave treatment and hydro-thermal treatment are combined for treating kitchen waste, the kitchen grease precipitated amount is increased by 10-50 % than that before treatment and is increased by 2-30% than that obtained by adopting single pretreatment, the kitchen grease precipitated amount is effectively increased, and the productivity and the yield of the biodiesel prepared through the enzymic method are obviously improved.
Owner:SOUTH CHINA AGRI UNIV

Production and purification method of glucose dehydrogenase by taking FAD (Flavin Adenine Dinucleotide) as prothetic group

The invention discloses a production and purification method of glucose dehydrogenase by taking FAD (Flavin Adenine Dinucleotide) as a prothetic group, and belongs to the field of bioengineering. Theproduction and purification method is characterized by expressing the glucose dehydrogenase sourced from burkholderia cepacia by taking Escherichia coli as a host, carrying out batch feeding, controlling the temperature in stages, and expressing the glucose dehydrogenase. According to the production and purification method disclosed by the invention, the activity of the glucose dehydrogenase is upto 22200.0U / L, and the mycelia content is up to 69.8g / L; a crude enzyme solution is separated and purified through three-step chromatography, so that recombinase of which the specific enzyme activityis 10<9>U / mg, the property problem of enzyme is solved, and the recombinase is suitable for industrial production.
Owner:JIANGNAN UNIV

Nucleic acid reagent, kit and system for detecting lower respiratory tract infection bacteria

The disclosure relates to a nucleic acid reagent for detecting lower respiratory tract infection bacteria. The nucleic acid reagent comprises primers shown in SEQ ID NO.1-24 and probes shown in SEQ IDNO.27-38 which are stored in a respective and independent manner or in a mutual and arbitrary mixing manner. Through the primers and probes described above, the nucleic acid reagent, a kit, a systemand a method for detecting 12 types of lower respiratory tract infection bacteria such as streptococcus pneumoniae, haemophilus influenzae, moraxella catarrhalis, pseudomonas aeruginosa, klebsiella pneumonia, acinetobacter baumannii, enterobacter cloacae, burkholderia cepacia, escherichia coli, staphylococcus aureus, enterococcus faecium, and enterococcus faecalis are established, at the same time, internal reference genes are added as controls, the above 12 types of bacteria can be quantitatively detected through a double standard curve method, the uniform quantification treatment of samplescan be performed, the fast, comprehensive, sensitive, specific and automatic detection result determination is realized, and sensitivity, specificity, and simplicity of simultaneously detecting the above detection target genomes are significantly improved.
Owner:CHINA JAPAN FRIENDSHIP HOSPITAL +1

Antibacterial compounds

Novel compounds having antimicrobial activity, in particular against Pseudomonas aeruginosa, Burkholderia cepacia and / or Clostridium difficile, and a pharmaceutical composition containing the novel compound.
Owner:UNIVERSITY OF NOTTINGHAM

A method for improving the yield of biodiesel produced by enzymatic method of cooking oil by using pretreatment

The invention belongs to the technical field of kitchen waste treatment, and specifically discloses a method for improving the yield of biodiesel produced by enzymatically preparing kitchen grease by utilizing pretreatment. The method comprises the following steps: S1. removing sundries in the kitchen waste, and sequentially subjecting the kitchen waste to microwave, ultrasonic and hydrothermal treatment; S2. separating the three phases to obtain the upper layer of grease; S3. passing in ozone for oxidation; S4 .Add immobilized compound lipase to the oil obtained in S3, and add short-chain alcohol to carry out transesterification to prepare biodiesel; wherein, the immobilized compound lipase described in S4 includes Geotrichum candidum lipase, Candida lipase and onion lipase Burkholderia lipase. The invention adopts microwave, ultrasonic and hydrothermal treatment to jointly treat kitchen waste, and the amount of kitchen grease precipitation increases by 10-50% compared with that before treatment, and increases by 2-30% compared with single pretreatment, effectively increasing the amount of kitchen grease precipitation, and significantly Improve the yield and yield of biodiesel produced by enzymatic method.
Owner:SOUTH CHINA AGRI UNIV

Microbial agent used for degrading quinclorac herbicides

InactiveCN111705024ADegradation of quinclorac contentFungiBacteriaAmylaseSucrose
The invention discloses a microbial agent used for degrading quinclorac herbicides. The microbial agent takes several strains of bordetella, arthrobacterium, bacillus megatherium, burkholderia cepacia, ochrobactrum anthropi, pseudomonas, alcaligenes faecalis, aspergillus niger and neurospora and cellulase, amylase, protease, lipase and a biological accelerating agent as raw materials, and fermented solutions obtained after the several strains of the bordetella, the arthrobacterium, the bacillus megatherium, the burkholderia cepacia, the ochrobactrum anthropi, the pseudomonas, the alcaligenes faecalis, the aspergillus niger and the neurospora undergo fermentation culture are mixed to form a mixed fermented solution, after thalli are collected by centrifugation from the mixed fermented solution, skimmed milk and sucrose are added, freeze drying is performed, and then, the thalli are compounded with the cellulase, the amylase, the protease, the lipase and the biological accelerating agentto obtain the microbial agent.
Owner:SHANDONG SUNWAY LANDSCAPE TECH

Specific detection target of BCC (Burkholderia cepacia complex) and constant-temperature rapid detection method

The invention provides a specific detection target of a BCC (Burkholderia cepacia complex) and a constant-temperature rapid detection method. The specific detection target is a sec Y gene, an RPA primer composition is designed according to the gene, the RPA primer composition comprises an upstream primer with a sequence selected from one of SEQ ID No.1 to SEQ ID No.6, a downstream primer with a sequence selected from one of SEQ ID No.7 to SEQ ID No.9, and a probe with a sequence as follows: CAGGGCAACGGAAGATCACGCAGTACACGCGG[FAM-dT]A[THF][BHQ1-dT]TCACCGTGGTGCTCG[C3Spacer]. On the basis, the invention develops a high-throughput and rapid screening and detection method for the specific BCC; and the method is high in accuracy, strong in specificity and high in sensitivity, and is suitable for daily screening work of medical institutions, medicine and medical equipment production enterprises, cosmetic production enterprises and related detection institutions.
Owner:SHANGHAI INST FOR FOOD & DRUG CONTROL

A special compound microbial agent for eliminating the obstacle of Pseudostellaria heterophylla and its preparation method

ActiveCN105779305BGood rhizosphere colonization abilityNo pathogenic infection abilityBiocidePlant growth regulatorsBiotechnologyContinuous cropping
The invention discloses a special compound microorganism bacterium agent capable of eliminating continuous cropping obstacles of radix pseudostellariae. The special compound microorganism bacterium agent is prepared from common probiotics and aboriginal probiotics at the volume ratio of 4 to 6, wherein the common probiotics are prepared by mixing lactic acid bacteria, photosynthetic bacteria, saccharomycetes and actinomyces at the volume ratio of 1 to 1 to 1 to 1; the aboriginal probiotics are prepared by mixing burkholderia, pseudomonas and bacillus at the volume ratio of 4 to 1 to 1. The invention further discloses a preparation method of the special compound microorganism bacterium agent capable of eliminating the continuous cropping obstacles of the radix pseudostellariae. The preparation method comprises the following steps: step 1, screening aboriginal antagonistic bacteria; step 2, preparing common compound bacterium liquid; step 3, activating and carrying out expanding culture on the aboriginal probiotics; step 4, preparing the compound microorganism bacterium agent. The special compound microorganism bacterium agent prepared by the method has a good root fixed planting capability and is safe and reliable, has obvious prevention and control effects on the continuous cropping obstacles of the radix pseudostellariae and soil-borne diseases, and has no pathogenic infection capacity on other succession crops.
Owner:FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products