Product
Patsnap Eureka
For R&D, Patsnap Eureka makes reading and utilizing patents & technical documents easy.
Patsnap Eureka AIR
Designed for self-driven R&D workflows. Generate viable solutions, solve complex R&D challenges, empower your innovation with AI.
Patsnap Eureka Materials
Designed for material experts only. Revolutionize your material R&D, from search, analyze, to developing new materials.
Feature
TechResearch
Generate reliable direction feasibility study reports for your R&D in just a few steps.
TechSeek
Discover and master advanced knowledge NOW. Basics, ideas, possibilities, all at once.
TechMind
As an expert in R&D Theories, TechMind can generates customized viable solutions instantly.
TechRisk
Analyze your overall solution with one click, know your potential R&D risks in advance.
TechMonitor
Get weekly tech updates, stay abreast of the latest tech innovations and key insights.
Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
344results about How to "Reliable detection method" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
Method for preventing evacuation of plunger pump based on monitoring of output pressure
ActiveCN106438310AImprove protectionThe detection method is accuratePump testingPump controlData acquisitionEngineering
The invention relates to the technical field of monitoring of plunger pumps, in particular to a method for preventing evacuation of a plunger pump based on monitoring of the output pressure. The method relates to the plunger and an output pipeline, and is characterized in that a pressure data acquisition control device is arranged on the outlet pipeline; and a data processing method comprises the following steps that (1) the average value P0 of the output pressure is obtained, specifically, the output pressure setting tolerance delta P is set, the domain above a P0+delta P line is called a peak domain, and the domain below a P0-delta P line is called a valley domain; a peak domain counter A and a valley domain counter B are set correspondingly; the allowable difference value between the peak domain counter A and the valley domain counter B is the numerical value C; and an out-of-tolerance time counter D and an upper limit E are set; (2) pressure data Px is acquired; (3) abnormal data are removed; (4) the number of times of Px falling into the peak domain and the valley domain is calculated; and (5) whether the out-of-tolerance time D of the difference value between the peak domain counter A and the valley domain counter B exceeds a preset value E or not is judged, and if yes, an evacuation alarm is given out. Compared with a detection method in the prior art, the method is accurate and reliable, and false alarms are avoided.
Owner:JEREH OIL & GAS ENG
A method for preventing plunger pump from pumping out based on monitoring output pressure
ActiveCN106438310BImprove protectionThe detection method is accuratePump testingPump controlData acquisitionEngineering
Owner:JEREH OIL & GAS ENG
Image detection method for detecting foreign matter at bottom of vehicle
ActiveCN103984961AMeet the needs of real-time detectionReliable detection methodImage analysisCharacter and pattern recognitionForeign matterImage detection
The invention relates to an image detection method for detecting foreign matter at the bottom of a vehicle. The method sequentially includes the following steps of image input, image registration, binary image acquisition and foreign matter detection. The method can be used for fast recognizing whether the bottom of the vehicle going in or out of a barrier gate carries foreign matter or not, a vehicle chassis image provided by a vehicle chassis imaging system is subjected to signal analysis and processing, a real-time reliable foreign matter detection method is provided for detection of the chassis of the vehicle, and therefore the foreign matter at the bottom of the chassis of the vehicle can be fast, accurately and efficiently detected, the detecting accuracy is improved, interference of manual operation and environment changes is eradicated, and the requirement for real-time detection of the bottom of the vehicle in the security and prevention market in China is met. The time needed for recognition is no longer than five seconds, and the recognition efficiency is high.
Owner:CHENGDU XIWU SECURITY SYST ALLIANCE
Para-gene for exogenous insertion vector of transgenic maize transformation event MON88017 and application thereof
InactiveCN102206632ASensitive detection methodThe detection method is accurateMicrobiological testing/measurementDNA preparationBiotechnologyBinding site
The present invention discloses a para-gene for an exogenous insertion vector of transgenic maize transformation event MON88017 and application thereof, the sequence of which is shown in table 1. The para-gene for the exogenous insertion vector of transgenic maize transformation event MON88017 provided by the invention can be used for specifically detecting whether the transgenic maize and related products contain transformation event MON88017 and the content of the transformation event; and the detection method is sensitive, accurate, simple and reliable, and has broad market prospects. The para-gene analyzes and confirms the sources of different bases in the para-sequence of the exogenous insertion vector of transgenic maize transformation event MON88017 for the first time, and determines the binding sites of the exogenous insertion vector sequence and the maize genome sequence, thus contributing to scientific research.
Owner:INST OF PLANT PROTECTION SHANDONG ACAD OF AGRI SCI
Bovine beta-casein quantitative determination kit and application thereof
ActiveCN103529138AAccurate quantitative detectionComplete range of configurationsComponent separationQuantitative determinationInternal standard
The invention provides a bovine beta-casein quantitative determination kit. The kit mainly comprises a bovine beta-casein specific peptide of which the amino acid sequence is VLPVPQK, an isotope labeled bovine beta-casein specific peptide (VL*PV*PQK) and an isotope labeled bovine beta-casein internal standard substance of which the amino acid sequence is QSVLSLSQSKVL*PV*PQKAVPYPQRD). According to the kit, the ration is limited to be 1mg / 100g, the reproducibility RSD less than 9.50 percent (n is equal to 11), the recovery in a food substrate is 73.41-93.88 percent (n is equal to 6), and the recovery in a powdered milk substrate is 91.62-107.28 percent (n is equal to 6); a sample is pre-treated simply and quickly, and is low in cost. The bovine beta-casein quantitative determination kit is applicable to multiple food substrates, and can be used for accurately quantitating macro and trace bovine beta-casein.
Owner:ZHEJIANG CENT FOR DISEASE CONTROL & PREVENTION
Test detecting tool for compression-type packer rubber sleeves
ActiveCN103293062AIncrease profitReduce use costMaterial strength using tensile/compressive forcesHydraulic cylinderEngineering
The invention discloses a test detecting tool for compression-type packer rubber sleeves. The test detecting tool comprises a center tube (1), a deblocking tube (24) and a canister-shaped hydraulic cylinder sleeve (10). The right end of the hydraulic cylinder sleeve (10) is in seal connection with the deblocking tube (24) by a canister-shaped connecting ring (16); a closed annular cavity (26) is formed between the hydraulic cylinder sleeve (10) and the deblocking tube (24); a canister-shaped piston (13) and a measuring ring (11) which is sleeved outside the deblocking tube (24) are disposed in the annular cavity (26); the piston (13) can push a baffle ring (5), a piston rod (7) and the measuring ring (11) to slide along the axis of the center tube (1); and a through hole (27) is disposed on the sidewall of the deblocking tube (24) and between the piston (13) and the connecting ring (16). The test detecting tool of the compression-type packer rubber sleeves not only can detect a plurality types of packer rubber sleeves, but also has the advantages of simple detection mode, high efficiency, high accuracy, low cost and the like.
Owner:PETROCHINA CO LTD
Synchronous detection method of tetracyclines, fluoroquinolones and sulfonamide antibiotics remained in water body
InactiveCN104730168AReduce usageLess usage, less environmental toxicityComponent separationAntibiotic YSolid phase extraction
The invention belongs to the technical field of detection of enrichment of remained antibiotics in a water body environment, and particularly relates to a synchronous detection method of tetracyclines, fluoroquinolones and sulfonamide antibiotics remained in the water body. The detection method comprises the following steps: (1) performing water sample pretreatment; (2) performing small-column enrichment of target antibiotics by using solid-phase extraction; (3) detecting on a machine by using high performance liquid chromatography and tandem mass spectrum. According to the method, once the sample feeding is carried out at one time, multiple antibiotics in the water body can be detected at the same time, the time consumption of a detection process is reduced, the detection accuracy and sensitivity are increased, the detection limit is low, and the condition of the trace amount of remained antibiotics in the water body environment can be detected; meanwhile, the detection method is convenient to operate and low in environment toxicity and is low in using amount of organic reagents.
Owner:CHINA UNIV OF GEOSCIENCES (WUHAN)
Method for detecting voltage zero cross near fault in travelling wave protection
InactiveCN1610206AReliable detection methodReliable methodEmergency protective circuit arrangementsFault locationWave shapeElectric power system
The present invention belongs to the field of relay protection technology for electric power system. Based on the characteristic that the small scale wavelet conversion waveform of current traveling wave has its main part far from the time axis while voltage zero-cross failure and near to the time axis normally, phase-analog conversion matrix T is used in calculating three line mode traveling waves and their energy, one line mode traveling wave with maximum energy is selected for wavelet conversion, and the number of the points with values exceeding the maximum Kw is calculated to judge whither to have zero-cross failure. The present invention provides reliable and effective method capable of separating zero-cross failure from other failures.
Owner:KUNMING UNIV OF SCI & TECH
Method for determining defects of multilayer binding vessel by acoustic emission
InactiveCN101710105AReliable detection methodReasonable simplificationMaterial analysis using acoustic emission techniquesStress distributionFracture mechanics
The invention relates to the technical field of safety assessment of pressure vessels with defects, in particular to a method for determining defects of a multilayer binding vessel by acoustic emission. Acoustic emission detection is carried out according to the structural features of the vessel so as to determine the defects. The method comprises the following steps of: (1) activating defects under overpressure, synchronously monitoring the defects in the vessel by acoustic emission, determining the overpressure during activating the defects and positioning the activated defect parts; (2) simplifying activated defects which cannot be determined by ultrasonic phased array rechecking according to the development direction of an acoustic emission event; (3) obtaining the stress distribution of the simplified defect parts by utilizing finite element calculation or a nomogram obtained on the basis of the finite element calculation so as to ensure that the simplified defects are on a maximum stress wall surface vertical to the simplified defects; and (4) based on defect simplification conditions, the stress of the simplified defect parts and material fracture toughness, reversely reasoning nominal initial sizes and tolerance sizes of the defects according to a fracture mechanics theory. The method has reliable detection means and reasonable simplification process and provides a foundation for the safety assessment of multilayer binding vessels.
Owner:SHANDONG UNIV +3
Method for eliminating poison from microcapsule algal in water body
ActiveCN1562821ARemove completelyHigh detoxification efficiencyTesting waterMultistage water/sewage treatmentWater sourceMicrocystis
The method includes following steps: to filter and clear alge in water by sand to reduce quantity of suspended substances and microcap frustule in water; next is plant absorbing process, a section of organic substances and microcystim are absorbed and decomposed by sandy soil plate which hygrophytes are planted on; the third is to further get rid of suspended substances and microcap frustule in water by active carbon adsorbing installation; the fourth is ozone process by blowing in high-density ozone containing air; the fifth is to detect content of microcystim in drinking water processed by method of high-effective liquid phase chromtograph detection.
Owner:INST OF AQUATIC LIFE ACAD SINICA
Method for detecting pre-treatment of nitrofurans metabolite
InactiveCN101949897ASolve a single problemExpensive to solveComponent separationMetaboliteEvaporation
The invention relates to a method for detecting pre-treatment of nitrofurans metabolite, comprising the following steps: (1) choosing a sample; (2) uniformly mixing the sample and extractant to obtain supernate; (3) adding the extractant to carry out extraction once again and obtaining mixed extractant; (4) adding derivatization reagent and catalyst to the mixed extractant and uniformly mixing the mixture; (5) cooling the mixture to room temperature; (6) adjusting the mixed extractant to neutrality and adding ethyl acetate to carry out extraction; (7) repeating the operation and combining ethyl acetate layers; (8) carrying out rotary evaporation on the mixture to be dry and adding methanol solution to dissolve residue; (9) activating a purification pillar to cause the methanol solution to pass through the purification pillar and obtaining and drying eluent; (10) adding acetonitrile aqueous solution and isooctane to the residue, dissolving and obtaining lower acetonitrile water layer; (11) causing the acetonitrile water layer to pass through a microfiltration membrane; and (12) analyzing and measuring the components and contents of the nitrofurans metabolite. The method of the invention is accurate, reliable and highly sensitive and enjoys good technical effect.
Owner:北京六角体科技发展有限公司
SNP (simple nucleotide polymorphism) modular marker for rice low cadmium accumulation gene OsHMA3 and application thereof
ActiveCN106480228AAccurate measurementOvercome expensiveMicrobiological testing/measurementDNA/RNA fragmentationAgricultural scienceCadmium Cation
The invention relates to an SNP (simple nucleotide polymorphism) modular marker for rice low cadmium accumulation gene OsHMA3; a detection site of the marker is at base 7431781 of chromosome 7 of rice. The invention also provides a primer set and method for detecting the SNP marker; the primer set has a sequence shown as in SEQ ID NO. 2-4. The SNP molecular marker and the primer set and method have the advantages that the SNP molecular marker is suitable for predicting the cadmium content of rice kernels before rice not bearing fruits, and suitable for accurate screening, such that breeding of low-cadmium-content varieties of rice is significantly promoted; the detection method is accurate and reliable and is simple to perform; the detection of SNP sites for rice OsHMA3 gene provides scientific basis for the breeding or improvement of low-cadmium-content kernel varieties of rice.
Owner:HUAZHI RICE BIO TECH CO LTD
Defect and stress non-destructive testing system and non-destructive testing method based on pulsed eddy current and Barkhausen
ActiveCN104977352AMixed Signal Simple and EffectiveReliable detection methodMaterial magnetic variablesData acquisitionFerromagnetism
The present invention provides a defect and stress non-destructive testing system and non-destructive testing method based on pulsed eddy current and Barkhausen, and belongs to the field of non-destructive testing. According to the present invention, the system comprises an excitation signal generator, a digital-to-analog converter, a power amplifier, an excitation coil, a Hall sensor, a signal amplification circuit, a data acquisition card and a computer; on the basis of eddy current testing, based on the ferromagnetic material, the mixed wave of the rectangular wave and the triangular wave is adopted as the excitation signal, the rectangular wave band at the first half section in the mixed signal produces the pulsed eddy current phenomenon, the triangular wave band at the later half section in the mixed wave produces the barkhausen effect, the sectional treatment is performed on the signal by using a signal time domain average method to achieve the separation of the eddy current signal and the Barkhausen noise signal, and the signal is respectively subjected to feature extraction and data processing so as to concurrently achieve online detection of the surface defect, the stress and the microstructure state of the ferromagnetic material and achieve the discrimination of the ferromagnetic material recessive defect, the prediction of the defect being not yet formed, and the prediction of the service life; and the method has characteristics of long-term and reliable work, high sensitivity, simpleness, intuitive display, high efficiency, feasibility, and the like.
Owner:江苏高特高金属科技有限公司
Method for measuring antigen protein in serum by chemiluminescence protein chips and kit
InactiveCN103823058AIncreased sensitivityImprove accuracyChemiluminescene/bioluminescenceFluorescence/phosphorescenceAntigenDisease
The invention relates to a method for measuring antigen protein in serum by chemiluminescence protein chips and a kit, which belongs to the medical detection technology. The method is characterized in that a chemiluminescence technology, a standard curve and a protein chip technology are combined for performing quantitative determination of certain antigen protein substance in serum, the high specialty and sensitivity of the chemiluminescence technology and the standard curve are employed for realizing the quantitative determination; the protein chip technology can realize simultaneous detection and analysis of several samples, so that the detection time consumption of a whole set ofe sample is greatly reduced, and the method has the characteristics of reliability, accuracy and low cost; and the method is suitable for general analysis of common antigen protein level in serum and quantitative analysis of great disease antigen marks, and the method is an medical auxiliary detection method having great meaning. The invention also provides a matched kit based on the method.
Owner:BEIJING YOUAN HOSPITAL CAPITAL MEDICAL UNIV
Underwater electric steering engine and rudder angle detection method
The invention relates to a steering gear, in particular to an underwater electric steering engine and a rudder angle detection method. The underwater electric steering engine comprises an output shaft, an engine base, a worm wheel, a worm, a power system and a steering engine controller. The power system drives the output shaft to rotate through transmission of the worm and the worm wheel. The output shaft extends out of the end, provided with a shaft end cap, of the engine base, and the output shaft is provided with a limiting swing piece at the end. A swing groove is formed in the shaft end cap. The limiting swing piece swings in the swing groove. The steering engine controller is connected with a motor in the power system. An incremental encoder is arranged on the motor. The limiting swing piece and the steering engine controller are used for determining the rudder angle zero point position. The incremental encoder is used for detecting angle change values of a motor output shaft so as to determine the absolute position of the current rudder angle. The power system is arranged in a shell. The shell communicates with the engine base, and the interior of the shell is an oil-filled sealed space. An oil pipe is connected with the shell. The underwater electric steering engine is compact in overall structure and capable of meeting operation demands of full-ocean-depth low-speed large-torque and large-moment output.
Owner:SHENYANG INST OF AUTOMATION - CHINESE ACAD OF SCI
Method for extracting and detecting biotin of bird nest
InactiveCN102539616AReduce distractionsSolve the phenomenon of insensitivity to ultraviolet absorptionComponent separationPreparing sample for investigationBiotinSilica gel
The invention provides a method for extracting and detecting a biotin of a bird nest. The method comprises the following steps of: extracting the biotin from the bird nest by using dimethylformamide; performing centrifugal purification and concentration to prepare a sample solution; by using a one-point external standard method, developing the sample solution and a biotin standard solution on a high-performance thin-layer plate coated with silica gel 60F254 by using a developer, wherein the developer is a mixture of chloroform, acetone, methanol and glacial acetic acid; spraying 0.05 percent of potassium permanganate solution to a developed plate for coloring; and drying the developed plate, and then performing thin layer scanning with absorption wavelength of 400 nm to obtain the contentof the biotin in the bird nest. The method has the advantages of simplicity, accuracy, quickness, stability and reliability, and the defects of complicated detection steps and high time consumption of the conventional microbiological method, and high investment cost, large solvent dosage and high cost of a high performance liquid chromatography are overcome.
Owner:SHANDONG NORMAL UNIV
Method for evaluating physiological bacterial wilt of paddy rice based on non-invasive micro-detection technology
ActiveCN102393416AShort timeImprove detection accuracyMaterial analysis by electric/magnetic meansIon currentInorganic ions
The invention relates to a rapid evaluating method for the physiological bacterial wilt of paddy rice. In the method, ion current of inorganic ions at the roots of the paddy rice seedlings is detected by adopting a non-invasive micro-detection technology; the physiological bacterial wilt can be judged if the ion current flows to paddy rice seedlings which are in the outward flowing state; and theinorganic ions are more than one or two of K<+>, NH<4+> and Ca<2>. The invention further provides application of the non-invasive micro-detection technology to the detection of the physiological bacterial wilt of paddy rice. Due to the adoption of the evaluating and detecting method, non-invasive, active and rapid detection of the physiological bacterial wilt of paddy rice can be realized, the comparison between net ion current of pathogenetic paddy rice seedlings and the net ion current of normal paddy rice seedlings is remarkable, one sample is detected within certain minutes, and the time consumption is low; and compared with a sense identification method, the evaluating method has higher accuracy. The detection method disclosed by the invention is simple and reliable, and has wide application prospect.
Owner:BEIJING RES CENT OF INTELLIGENT EQUIP FOR AGRI
CAPS molecular marker primer for detecting CMS (cytoplasmic male sterility) restoring genes of capsicum annuum and application of CAPS molecular marker primer
InactiveCN108411027AImprove accuracyVerify validityMicrobiological testing/measurementDNA/RNA fragmentationAgricultural scienceCO-DOMINANT
The invention relates to the field of biotechnology-assisted seed breeding, and particularly discloses a CAPS molecular marker primer for detecting CMS (cytoplasmic male sterility) restoring genes ofcapsicum annuum and application of the CAPS molecular marker primer. CAPS molecular markers are tightly linked with the CMS restoring genes of the capsicum annuum and are M1 markers. The CAPS molecular marker primer and the application have the advantages that detection can be facilitated by the CAPS molecular markers, stable and reliable results can be obtained, the CAPS molecular markers are co-dominant markers, and accordingly sterility restoring genes of capsicum annuum strains can be detected on a large scale only by means of simple conventional experiment operation such as hereditary substance extraction, PCR (polymerase chain reaction), restriction incision enzyme digestion and routine agarose electrophoresis; the selective breeding ranges of restoring line materials for the capsicum annuum can be expanded by development and application of the CAPS molecular markers, the seed breeding efficiency can be improved, seed breeding progresses can be accelerated, and the CAPS molecularmarker primer and the application have important significance in molecular marker-assisted seed breeding for CMS three-line matched seed production and restoring line materials for the capsicum annuum.
Owner:WUHAN ACADEMY OF AGRI SCI
Method and device for inspecting display unit connecting state
A method for detecting connection state of display device includes utilizing detection unit to detect connection state of display device plug and display device socket, sending detected signal to system and judging that display device is connected on if detected signal presents that display device plug and display device socket is physically connected on or otherwise judging that display device is not connected on. The detection device used for realizing said method is also disclosed.
Owner:LENOVO (BEIJING) LTD
Air conditioner and air conditioner throttling device blockage detection method and system
InactiveCN107461883AReliable detection methodSimple and reliable processSpace heating and ventilation safety systemsLighting and heating apparatusEvaporatorElectricity
The invention provides an air conditioner and an air conditioner throttling device blockage detection method and system. The air conditioner comprises a compressor, an indoor unit, an indoor unit evaporator and a counter. The detection method comprises the steps of (1) acquiring the state of the compressor after the air conditioner is powered on and started up; (2) judging whether the continuous running time of the compressor reaches the first preset time t1 or not when the compressor is in a running state; (3) if yes, further judging whether the running frequency of the compressor within the first preset time t1 is greater than the preset frequency f1; (3) if yes, acquiring the running current I1 of the air conditioner and / or the air intake temperature T1 of the indoor unit and the temperature T2 of the indoor unit evaporator at the intervals of the second preset time t2; and (4) judging whether a throttling device of the air conditioner is blocked or not according to the running current I1 of the air conditioner and / or the air intake temperature T1 of the indoor unit and the temperature T2 of the indoor unit evaporator. By means of the method, whether the throttling device of the air conditioner is blocked or not can be detected, and the detection method is simple and reliable.
Owner:GD MIDEA AIR-CONDITIONING EQUIP CO LTD
Quality factor-based device and method for detecting loudspeaker module sealing
ActiveCN104515659AAvoid destructionAvoid misjudgmentFluid-tightness measurement using electric meansElectrical resistance and conductanceSound quality
The invention provides a quality factor-based device and method for detecting loudspeaker module sealing. The quality factor-based device comprises a signal source, a power amplifier, a precision resistor, a voltage testing unit and a sealing tool. The power amplifier is used for amplifying signals sent from the signal source. The precision resistor is sequentially connected between the power amplifier and a loudspeaker module for testing. The loudspeaker module for testing, the amplifier and the precision resistor are in a series loop. The voltage testing unit is used for detecting voltage at two ends of the precision resistor. The sealing tool is used for sealing a sound hole of the loudspeaker module for testing. According to the arrangement, by the aid of airflow resistance generated during running of the loudspeaker, loudspeaker impedance and quality factors are acquired, thus the sealing of the loudspeaker module is detected, and the problem that after entering water, the sound quality of the loudspeaker is damaged and misjudged is solved.
Owner:GOERTEK INC
Padlock probe for detecting Acidovorax avenae subsp.citrulli and detection method
InactiveCN101608234AAvoid false positivesRealize detectionMicrobiological testing/measurementMicroorganism based processesAcidovorax speciesQuarantine
The invention relates to a padlock probe for detecting Acidovorax avenae subsp.citrulli and a detection method, belonging to the fields of disease prevention and treatment of crops and quarantine of plants. A padlock probe sequence P-a.a.c for detecting the Acidovorax avenae subsp.citrulli is CGGCACGGTGCAGTTTCCTGCTTTCCGCPIP2CCTTACGCTAGGTCGAGAGTATTTTTGTCACCGG. The detection method combined with a Macroaary technique on the basis of the probe has strong specialty, sensitivity and stability; and a rapid, sensitive and special method is provided for detecting the Acidovorax avenae subsp.citrulli. The figure shows the detecting result of the padlock probe detecting the Acidovorax avenae subsp.citrulli.
Owner:NANJING AGRICULTURAL UNIVERSITY
Ultra performance liquid chromatography (UPLC)-triple quadrupole/composite linear ion trap mass spectrometry detection method of triphenylmethanes and metabolites of triphenylmethanes in water bodies
ActiveCN103439445AImprove scan performanceReliable detection methodComponent separationMaterial analysis by electric/magnetic meansMetaboliteEcological environment
The invention belongs to the technical field of environmental monitoring and in particular relates to an ultra performance liquid chromatography (UPLC)-triple quadrupole / composite linear ion trap mass spectrometry detection method of triphenylmethanes and metabolites of triphenylmethanes in water bodies. Currently, the detection methods which can be used for simultaneously detecting five substances, including MG, LMG, CV, LCV and BG, and have detection limits up to ng level are not available yet. The method has the beneficial effects that a device adopts composite mass spectra, is an advanced novel mass spectrograph and adopts quadrupole / linear ion trap technology, thus greatly improving the MS / MS scanning capacity; meanwhile, the advanced novel mass spectrograph is connected with an UPLC, so that a simple, quick and sensitive method can be established; five triphenylmethanes and metabolites thereof in water bodies are simultaneously determined, thus providing a reliable detection method for further analyzing and evaluating the pollution conditions in the ecological environments.
Owner:JIANGSU ENVIRONMENTAL MONITORING CENT
Method for extracting biotin from Antarctic krill and high-efficiency thin layer scanning analysis method
InactiveCN102735512AReduce distractionsInsensitivity to UV absorptionComponent separationPreparing sample for investigationMethylene DichlorideBiotin
The invention discloses a method for extracting biotin from Antarctic krill and a high-efficiency thin layer scanning analysis method. The method comprises the steps of: extracting biotin from Antarctic krill by using dimethyl formamide; centrifuging, removing impurities and concentrating to prepare a sample solution; spreading the biotin standard sample solution on a high-efficiency thin-layer plate coated with silica gel GF254 by adopting an external standard one point method, wherein a spreading agent is a mixed solution prepared from methylene dichloride, isopropanol, methanol and glacial acetic acid in proportion; spraying for dying the spread spradig plate by adopting a dying solution; putting the plate into a fume cupboard, and after five minutes, spraying a 10% of paraffin-chloroform solution; and carrying out thin-layer scanning with an absorption wavelength of 530nm, and calculating the content of the biotin in the Antarctic krill. The method has the advantages of simplicity, accuracy, rapidness, reliability and stability.
Owner:SHANDONG NORMAL UNIV
Alarming device for preventing students from being missedmissing in school bus and control method of alarming device
InactiveCN102963254AThe detection method is simpleReliable detection methodAcoustic signal devicesTractorsAlarm deviceEmbedded system
The invention discloses an alarming device for preventing students from being misseding in a school bus and a control method of the alarming device. A normally-closed switch is arranged below a seat of each passenger in the school bus; according to the normally-closed switch, one lead is connected in series into an alarming controller or a bus body controller to form a circuit; and one end of the alarming controller or the bus body alarm outputs current to one end of the lead for detecting whether the lead is conducted or not. The alarming device has the advantages of simple, reliable and effective detection mode, high application flexibility, low cost and considerable protection strategy.
Owner:ANHUI NORMAL UNIV
Enzyme-linked immunosorbent assay method for detecting cadmium-metallothionein in flesh of shell
InactiveCN101900726AThe principle is scientific and reasonableThe technical steps are matureMaterial analysisElectrophoresisCadmium metallothionein
The invention discloses an enzyme-linked immunosorbent assay method for detecting cadmium-metallothionein in the flesh of a shell. The method comprises the following steps of: inducing the shell to synthesize the cadmium-metallothionein by using cadmium chloride, inducing a rabbit to synthesize an antibody by using purified metallothionein, separating and purifying the antibody, using an electrophoretically pure rabbit anti-shell metallothionein antibody as a primary antibody and a goat anti-rabbit enzyme labelled antibody as a secondary antibody, and assaying the cadmium-metallothionein content of the shell by using the indirect competitive enzyme-linked immunosorbent assay method. The method has the advantages of scientific and rational principle and relatively mature technical process and is used for assaying the cadmium-metallothionein content of the flesh of the shell so as to indirectly reflect the cadmium pollution of the flesh of the shell and provide a fast and sensitive detection method for assaying the heavy metal cadmium in the flesh of the shell.
Owner:GUANGDONG OCEAN UNIVERSITY
Ion chromatography detection method for six negative ions in cigarette paper
ActiveCN105784908AImprove extraction efficiencyEasy extractionComponent separationIon chromatographyFormate
The invention discloses an ion chromatography detection method for six negative ions in cigarette paper.Ultrapure water is adopted as an extracting agent, IonPac AS19 negative ion exchange columns are separation columns, chromatographic conditions are optimized in a targeted mode, and the ion chromatography is adopted for achieving quantitative analysis of lactate, acetate, formate, chloridion, phosphate radicals and citrate in cigarette paper samples.A result shows that the recycling rates of the six negative ions range from 91.0% to 109.5%, and the relative standard deviation ranges from 0.82% to 6.26%.The method is accurate, simple, reliable and applicable to quantitative determination of relative components, particularly six negation ions in the cigarette paper samples.
Owner:CHINA TOBACCO GUANGDONG IND
Padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and multiple detection method
InactiveCN101608236ASignificant technological progressEnable multiple detectionMicrobiological testing/measurementMicroorganism based processesQuarantineErwinia
The invention provides a padlock probe for detecting erwinia amylovora and Asian erwinia amylovora and a multiple detecting method, belonging to the fields of disease prevention and disease treatment of crops and quarantine of plants. A padlock probe sequence P-e.amy for detecting the erwinia amylovora is GACTTCGCAGGCGCCTTGCTCATTACTTPIP2ATCGGCCTGTAATCGGATCGACACGGTGTGTCGC. A padlock probe sequence P-e.pyr for detecting the Asian erwinia amylovora is TATGGCGTCCCCAAGGGGATTCGAACCCPIP2CCGACTCTAGGATCGTGGATCACTTCGTTACCGG. The method multiple detection is combined with a Macroaary technique on the basis of the probe to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora and has strong specialty, sensitivity and stability; and and a rapid, sensitive and special method is provided for detecting the erwinia amylovora and the Asian erwinia amylovora. The figure shows the result of combining the padlock probe and the macroaary technique to simultaneously detect the erwinia amylovora and the Asian erwinia amylovora.
Owner:NANJING AGRICULTURAL UNIVERSITY
CAPs (C1eaved Amplified Polymorphic Sequences) molecular marker for identifying amaranthus tuberculatus based on SNP (Single Nucleotide Polymorphism) site and application thereof
InactiveCN106498088ARapid detection and identificationAccurate detection and identificationMicrobiological testing/measurementInvasive species monitoringNucleotideAmaranthaceae
The invention provides a CAPs (C1eaved Amplified Polymorphic Sequences) molecular marker for identifying amaranthus tuberculatus based on an SNP (Single Nucleotide Polymorphism) site and application thereof. The molecular marker is located on ITS (Internal Transcribed Spacers) and 26S sequences of an amaranthaceous plant nuclear gene, and a nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1. Primer pair sequences for amplifying the molecular marker are as shown in SEQ ID NO.2 and SEQ ID NO.3. The specific molecular marker provided by the invention can realize rapid and accurate detection of the amaranthus tuberculatus and a reliable detection method is provided for rapid distinguishing and identification of alien invasive species.
Owner:CHINESE RES ACAD OF ENVIRONMENTAL SCI
Biological sensor with micro-electrode and application of biological sensor to detecting salicylic acid of plants in online manner
InactiveCN106770570AWon't hurtWon't breakMaterial electrochemical variablesSalicylic acidCarbon nanotube
The invention provides a biological sensor with a micro-electrode. The length of the micro-electrode is 4-8 cm, the length of a tip of the micro-electrode is 5-30 mm, the width of the tip of the micro-electrode is 2mm, and the thickness of the tip of the micro-electrode is 0.5mm; substrate electrodes of the micro-electrodes are made of silicon wafers, the micro-electrode is provided with a three-electrode system and comprises an Ag / AgCl reference electrode, a platinum counter electrode and a gold working electrode modified by carbon nano-tube materials, and the lengths*the widths of exposed conductive portions of the three electrodes are 0.5mm*0.5mm. The biological sensor has the advantages that the content of salicylic acid of plant bodies can be monitored by the aid of living bodies in an online manner, change conditions of the content of the salicylic acid can be truly recorded and can be analyzed in real time, detection methods are reliable, accurate measurement results can be obtained, the novel methods can be provided for detecting the salicylic acid of plants, and salicylic acid detection means can be enriched in research on the stress resistance and the disease resistance of the plants.
Owner:BEIJING RES CENT FOR INFORMATION TECH & AGRI
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Patsnap Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com