Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

152 results about "Staphylococcus caprae" patented technology

Staphylococcus caprae is a Gram-positive, coccus bacteria and a member of the genus Staphylococcus. S. caprae is coagulase-negative. It was originally isolated from goats (caprae means "of a goat"), but members of this species have also been isolated from human samples.

Enterococcus faecium ANSE228 and application thereof

The invention provides an Enterococcus faecium ANSE228 of which the collection number is CGMCC No.4082. The invention also provides application of the Enterococcus faecium ANSE228 to inhibition of salmonella pullorum and / or Escherichia coli and / or Staphylococcus aureus. The Enterococcus faecium ANSE228 is obtained by processes of repeated separation, purification, rejuvenation and the like, and has high biological activity, obvious probiotic property, high adversity resistance and the like. The invention also provides a microecological agent which contains the Enterococcus faecium ANSE228. When the microecological agent is added into drinking water and / or feeds for breeding animals, the Enterococcus faecium ANSE228 can be quickly activated and reproduced and a dominant beneficial flora can be formed after the Enterococcus faecium ANSE228 is fed into intestinal canals of the animals, and the Enterococcus faecium ANSE228 has the effects of reducing a harmful flora in the intestinal canals, adjusting microecological balance of the intestinal canals, substituting for medicaments such as antibiotic and the like, and improving weight increment of the animals and the utilization rate of the feeds.
Owner:科润生科技发展有限公司

Podoviriedae bacteriophage having killing activity specific to staphylococcus aureus

The present invention relates to a novel bacteriophage, more precisely a Podoviridae bacteriophage having killing activity specific to Staphylococcus aureus which is the causing agent of infectious disease in human and animals, a pharmaceutical composition for the prevention and treatment of the disease caused by Staphylococcus aureus, an antibiotic and a disinfectant containing the bacteriophage as an active ingredient.
Owner:INTRON BIOTECHNOLOGY INC

Bacillus subtilis

The invention relates to bacillus subtilis CH-001, which was collected in China Center for Type Culture Collection (CCTCC) on April 8th, 2011. The collection number is CCTCC NO: M 2011111. The bacillus subtilis has the characteristic of degrading keratin in a broad spectrum manner and has mild degradation and fermentation conditions, high enzyme production activity and high stability. The bacillus subtilis can generate high-activity keratinase, can degrade collagen, has antagonism on pathogenic bacteria such as staphylococcus aureus and the like, has the characteristics of probiotics, and is applicable to engineering bacteria development for fermentation production of animal protein feed additives and keratinase. The bacillus subtilis avoids the conflict between high-activity keratinase generated by most microorganisms and pathogenicity of the microorganisms on human or poultry and the broad spectrum characteristic on the keratin, and the antagonism on the related pathogenic bacteria is researched. The bacillus subtilis is a low-carbon, economic, high-efficiency, safe and green biological resource and has huge potential value for creation of economic and social benefits.
Owner:HUNAN AGRICULTURAL UNIV

Kit for rapid detection of staphylococcus aureus in sample and detection method thereof

The invention discloses a kit for rapid detection of staphylococcus aureus in a sample and a detection method thereof, belonging to the technical field of immunological detection. In the invention, a staphylococcus aureus immunogen inactivated with formaldehyde is used for immunizing a healthy New Zealand rabbit to obtain a polyclonal antibody to serve as a coated antibody, and used for immunizing a BALB / C mouse and performing cell fusion to obtain a monoclonal antibody to serve as a secondary antibody, thus, the kit for performing a double antibody sandwich enzyme-linked immunosorbent assay on the staphylococcus aureus in food (milk) is established, and a rapid and efficient detection means is provided for residual detection of the staphylococcus aureus in the food, and the advantages of lower cost and better stability and repeatability are achieved. A detection limit of the kit is 105cfu / mL and is suitable for detecting mass samples.
Owner:JIANGNAN UNIV

Methicillin-resistant staphylococcus epidermidis staphylococcus aureus bacteriophage and antimicrobial application thereof

The invention relates to a bacteriophage and antimicrobial application thereof, in particular to a methicillin-resistant staphylococcus epidermidis staphylococcus aureus bacteriophage and antimicrobial application thereof, and belongs to the field of bioengineering. The methicillin-resistant staphylococcus epidermidis staphylococcus aureus bacteriophage is preserved in China Center for Type Culture Collection (CCTCC), located in Wuhan University of Wuhan of China, on September 17, 2015. The collection number is staphylococcus aureus bacteriophage qdsa002 of CCTCC M2015554. The Latin scientific name is staphylococcus aureus bacteriophage qdsa002. The bacteriophage has high splitting effect on staphylococcus aureus, especially methicillin-resistant staphylococcus epidermidis staphylococcus aureus. The preparation can be used individually or compounded with other drugs, and a safe bacteriophage product source free of toxic and side effects is provided for control of methicillin-resistant staphylococcus epidermidis staphylococcus aureus contamination.
Owner:OCEAN UNIV OF CHINA

LAMP primer combination for detecting 6 infectious pathogens of dairy cow mastitis and application thereof

The invention discloses an LAMP primer combination for detecting 6 infectious pathogens of dairy cow mastitis and application thereof. The invention first provides a primer combination consisting of 36 DNA molecules shown in sequence 1 to sequence 36. The primer combination can be used for detecting whether a to-be-detected bacterium is Mycoplasma bovis, Staphylococcus aureus, Streptococcus agalactiae, Streptococcus pyogenes, Corynebacterium bovis or Staphylococcus epidermidis, and can be used for detecting whether a to-be-detected sample contains Mycoplasma bovis and / or Staphylococcus aureusand / or Streptococcus agalactiae and / or Streptococcus pyogenes and / or Corynebacterium bovis and / or Staphylococcus epidermidis. The primer combination provided by the invention is used for identifying and detecting the 6 infectious pathogens of dairy cow mastitis, has high specificity and high sensitivity, and can realize simple, rapid and accurate detection, thus having great popularization value.
Owner:CAPITALBIO CORP

Method of protecting against staphylococcal infection

A method of preventing or treating staphylococcal bacterial infection in an individual is disclosed. A vaccine based on a conjugate the 336 polysaccharide antigen can be used for active protection in individuals who are to be subjected to conditions that place them at immediate risk of developing a bacterial infection, as would be case in the context of a catheterization or a surgical procedure. Alternatively, antibodies raised in response to the antigen can be used to treat or to provide passive protection to individuals. The method can be used in a population of patients at risk for infection by various species of Staphylococcus or various types of Staphylococcus aureus.
Owner:GLAXOSMITHKLINE BIOLOGICALS SA

Application of Cathelicidin-bf Antimicrobial Peptide from Golden Krait

The invention belongs to the technical field of biomedicine, and in particular relates to the application of cathelicidin-BF, an antibacterial peptide of ceratopsia, in the preparation of medicines for treating bacterial vaginosis. The antibacterial peptide cathelicidin-BF of the present invention has the beneficial characteristics of strong bactericidal effect and rapid sterilization on Staphylococcus aureus and Escherichia coli in vitro; the effect of cathelicidin-BF on vaginitis caused by E. The results of coccus-infected vaginitis are basically the same, and it can significantly inhibit Staphylococcus aureus or Escherichia coli in the vagina, and cathelicidin-BF has an obvious effect of reducing inflammation; it can be used in the preparation of drugs for treating bacterial vaginosis.
Owner:KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI

Staphylococcus aureus phage strain and application thereof

The invention provides a staphylococcus aureus phage strain VB_SavM_JYL01. The staphylococcus aureus phage stain VB_SavM_JYL01 has been preserved in the China Center for Type Culture Collection on 25th March, 2018, the preservation name is Staphylococcus aureus phage VB_SavM_JYL01, and the preservation number is CCTCC M 2018154. The staphylococcus aureus phage strain has a wide lysis spectrum, thus staphylococcus aureus can be lysed, certain staphylococcus epidermidis can also be lysed, host bacteria 206 can be lysed, and staphylococcus clinical strains separated from the environment or fecesof diseased animals can also be lysed; the staphylococcus aureus phage can be used independently or in combination with other substances, and a safe and nontoxic phage disinfecting and killing productis provided for disinfecting and purifying the environment.
Owner:JILIN UNIV

Method of protecting against staphylococcal infection

A method of preventing or treating staphylococcal bacterial infection in an individual is disclosed. A vaccine based on a conjugate of PS1 polysaccharide antigen can be used for active protection in individuals who are to be subjected to conditions that place them at immediate risk of developing a bacterial infection, as would be case in the context of a catheterization or a surgical procedure. Alternatively, antibodies raised in response to the antigen can be used to treat or to provide passive protection to individuals. The method can be used in a population of patients at risk for infection by various species of Staphylococcus or various types of Staphylococcus epidermidis.
Owner:GLAXOSMITHKLINE BIOLOGICALS SA

Bovine-derived anti-staphylococcus aureus single-chain antibody, preparation method and application thereof

The invention relates to a bovine-derived anti-staphylococcus aureus single-chain antibody. The antibody at least comprises a light chain variable region of an amino acid sequence which is represented in SEQ ID No.1, a heavy chain variable region of an amino acid sequence which is represented in SEQ ID No.2 and an intermediate connecting peptide which is located between the light chain variable region and the heavy chain variable region. The single-chain antibody can be specifically bound with staphylococcus aureus, has certain external neutralization activity and has good application prospects when used in related reagents or drugs for diagnosing, preventing and treating staphylococcus aureus bovine mastitis.
Owner:SHANGHAI JIAO TONG UNIV

Cholera Toxin Chimera and its Use as a Staph Vaccine

The present invention relates to chimeric protein vaccines and methods of use thereof in the treatment of Staphylococcus aureus. One embodiment of the present invention provides a method of generating an immune response in a mammal, that includes administering to the mammal, a composition having a chimeric protein having at least one of: a portion of a cholera toxin, a portion of a heat-labile toxin, and a portion of a shiga toxin; and an antigen having at least one of an antigenic material from S. aureus and an antigenic material from a S. aureus-specific polypeptide.
Owner:BOISE STATE UNIVERSITY

Multiple PCR detection primers of escherichia coli, pseudomonas aeruginosa and staphylococcus aureus, kit and detection method

The invention discloses multiple PCR detection primers of escherichia coli, pseudomonas aeruginosa and staphylococcus aureus, a kit and a detection method. Specific primers are designed by means of combined utilization of escherichia coli alkaline phosphatase gene, pseudomonas aeruginosa outer membrance proteins gene and staphylococcus aureus heat-resistant nuclease gene sequences, multiple PCR detection is conducted on a sample by means of the specific primers according to the method, and specific detection of the escherichia coli, the pseudomonas aeruginosa and the staphylococcus aureus in the sample can be achieved at a time; the detection time is short, operation is easy and convenient, the detection efficiency can be effectively improved, the requirement of rapid detection is met, the sensitivity is high, the specificity is high, and the multiple PCR detection primers of the escherichia coli, the pseudomonas aeruginosa and the staphylococcus aureus, the kit and the detection method can be applied to microbiological detection work of cosmetics.
Owner:GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY

Staphylococcus aureus vaccine and preparation method thereof

The invention discloses a staphylococcus aureus vaccine and a preparation method thereof. Staphylococcus aureus is inactivated through radiation and adjuvants are added, so that the proliferative activity of the staphylococcus aureus loses and the metabolic activity of the staphylococcus aureus is reserved; compared with thermal inactivation and inactivation with such chemicals as formaldehyde and the like, protein and polysaccharide antigens on the surface of the bacterium body (the staphylococcus aureus) can be well reserved, and immune response and immune protection can be comprehensively and obviously induced. The preparation method is simple and convenient and is suitable for the large-scale preparation of the staphylococcus aureus vaccine; the preparation method is not only suitable for preparing the staphylococcus aureus vaccine, but also capable of serving as a rapid response strategy of bio-threat or newly emerging pathogens; especially, for pathogens which are not clear in immune response mechanism, a candidate vaccine can be rapidly prepared by virtue of the method; and the method can shorten research and development time and can reduce research and development cost.
Owner:SICHUAN YUANDASHUYANG PHARM CO LTD

Acapsular type staphylococcus aureus extracellular polysaccharide-protein conjugate and preparation method thereof

The invention relates to an acapsular type staphylococcus aureus extracellular polysaccharide-protein conjugate and a preparation method thereof. The acapsular type staphylococcus aureus extracellular polysaccharide-protein conjugate is prepared by performing covalent coupling on extracellular polysaccharide of acapsular type staphylococcus aureus and protein under the action of a coupling reagent. The preparation method is an antidiuretic hormone (ADH) bridge method or an l-ethyl-3(3-diaminopropyol)-carbodiimide (EDAC) zero-distance crosslinking method. The preparation of the acapsular type staphylococcus aureus extracellular polysaccharide-protein conjugate provides a strong technical support for development of a vaccine for preventing staphylococcus aureus.
Owner:新疆维吾尔自治区畜牧科学院兽医研究所

Quintuple fluorescent PCR detection kit for foodborne pathogenic bacteria

The invention provides a quintuple fluorescent PCR detection kit for foodborne pathogenic bacteria. The quintuple fluorescent PCR detection kit for foodborne pathogenic bacteria mainly comprises five pairs of specific primers, an EvaGreen PCR premixed solution, ultrapure water and a positive control, wherein the specific primers comprise the nuc genes of staphylococcus aureus, the hlyA genes of listeria monocytogenes, the invA genes of salmonella, the tlh genes of vibrio parahaemolyticus and the ipaH genes of Shigella. The kit provided by the invention is short in detection period, low in detection cost, and reliable in detection result.
Owner:嘉兴市疾病预防控制中心

Two staphylococcus aureus protein antigens and preparation method and use thereof

The invention belongs to the field of molecular biology and immunology. The invention relates to three truncated proteins of a staphylococcus aureus iron regulation surface determining protein B (IsdB) and a staphylococcus aureus alpha-hemolysin (Hla) attenuated protein, and their coding genes, preparation method and use. The invention also relates to the combined use of the three truncated proteins and the alpha-hemolysin attenuated body.
Owner:CHANGCHUN BCHT BIOTECH +1

Method of detecting salmonella, shigella and staphylococcus aureus

The invention discloses a method of detecting salmonella, shigella and staphylococcus aureus, which includes the following steps: 1) mixing a to-be-tested sample with a liquid culture medium and performing cultivation to the mixture under a condition which enables bacteria possibly existing in the to-be-test sample to be amplified to obtain an amplified sample; 2) capturing the salmonella, the shigella and the staphylococcus aureus, which possibly exist in the amplified sample, by means of immunomagnetic beads which are prepared through coupling of an antibody and magnetic spheres; 3) extracting the genome DNA of the bacteria captured in the step 2); and 4) with a specific primer aiming to the salmonella, the shigella and the staphylococcus aureus, performing multiple fluorescent quantitative PCR to the extracted genome DNA to determine the existence of the salmonella, the shigella and the staphylococcus aureus in the to-be-tested sample. The method achieves simultaneous detection of the salmonella, the shigella and the staphylococcus aureus, is high in sensitivity and is accurate in result.
Owner:BEIJING CENT FOR PHYSICAL & CHEM ANALYSIS +1

Application of luteolin in bacterial quorum sensing inhibition system

The invention relates to the technical field of medicine, and provides application of luteolin in a bacterial quorum sensing inhibition system, application of luteolin in preparing drug for lowering pathogenicity of staphylococcus aureus virulence factors and application of luteolin in preparing drug for inhibiting transcription of hla and agrA genes of staphylococcus aureus. Minimum effective concentration with application value is provided for the application of luteolin in the bacterial quorum sensing inhibition system, and a reference is provided for medically preparing specific bio-film forming inhibitors. The invention further provides a drug combination for inhibiting formation of staphylococcus aureus bio-films. The drug combination contains luteolin. According to the drug combination, formation of the bio-films of staphylococcus aureus can be inhibited by effectively inhibiting a quorum sensing system of staphylococcus aureus through tiny luteolin, prognosis risk, of staphylococcus aureus, for infection with high-drug-tolerance bio-films in anti-infection treatment is lowered, and a valuable reference is provided for medically preparing specific preparations for inhibiting the staphylococcus aureus bio-films.
Owner:THE SECOND AFFILIATED HOSPITAL ARMY MEDICAL UNIV

Pig origin saliva lactobacillus viable bacteria preparation and application

The invention provides a pig origin saliva lactobacillus viable bacteria preparation and an application and relates to the technical field of creatures. The preparation has a probiotic function on pigs, the colonization of the preparation in the enteric canal is guaranteed, wherein bacterial strains are gram staining positive and identified as Lactobacillus salivarius, the major biological characteristic is G+, and thalluses are of short rod shape; the preparation is facultative anaerobic, not capable of high temperature resistance, and has a certain inhibiting effect on escherichia coli and staphylococcus aureus; according to the production process, the preparation comprises slant strains, shake flask seed solution, a fermentation tank, suspending agents and products, and animal experiments demonstrate that the diarrhea rate of pigs is reduced, the growth rate of pigs is improved, the feed conversion rate is reduced through the use, and the usage amount of antibiotics in the pig-feeding process is reduced.
Owner:ANHUI TECH BANK BIO TECH

Fusion protein surface immunogenic protein-target of RNA III activating protein (SIP-TRAP) for preventing bovine mastitis and preparation method and use thereof

The invention provides a fusion protein SIP-TRAP and a preparation method and use thereof. The fusion protein SIP-TRAP is obtained inserting a fusion gene formed by connecting the SIP gene of streptococcus agalactiae and the TRAP gene of staphylococcus aureus into a vector and performing expression and purification. Experiments indicate the protein has high immunogenicity and that the immune effect of the protein is better that that of SIP and TRAP alone and that of the combination of SIP and TRAP. The SIP-TRAP protein provided by the invention can serve as an immunogen to improve the resistance of cow or sheep to infection with streptococcus agalactiae and staphylococcus aureus, simplifies the process of immune operation and has good immune effect.
Owner:HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY

Screening method for clostridium butyricum producing efficient antibacterial peptide butyrisin

InactiveCN104611411AEnhance the effect of non-specific immunityPromote Microecological BalanceMicrobiological testing/measurementBacteroidesEscherichia coli
The invention discloses a screening method for clostridium butyricum producing efficient antibacterial peptide butyrisin. The method includes the following steps in order: 1) performing preliminary screening based on the bacteriostatic activity of a fermentation bacterial broth: taking Escherichia coli and Staphylococcus aureus as the indicator bacteria to perform preliminary screening on to-be-tested strains, thus obtaining clostridium butyricum having antibacterial activity on Escherichia coli and Staphylococcus aureus; and 2) verifying the expression of antibacterial peptide butyrisin protein gene by PCR. The PCR positive strain is clostridium butyricum producing efficient antibacterial peptide butyrisin. By the method provided by the invention, the clostridium butyricum producing efficient antibacterial peptide butyrisin can be obtained. The antibacterial peptide has antibacterial activity on bacteria including but not limited to E.coli ATCC25922, E.coli K88, S.aureus ATCC25923 and the like.
Owner:ZHEJIANG UNIV

Kit and method for detecting staphylococcus aureus and integron in food

The invention discloses primers, probes, a kit and a method for detecting staphylococcus aureus and integron int1 in food. The primers comprise staphylococcus aureus primers and integron primers; sequences of the staphylococcus aureus primers are as follows: a sequence of a forward primer SAF is ATTCCGGATAACGCTTGCCA, and a sequence of a reverse primer SAR is AGGGAATCTTCCGCAATGGG; sequences of the integron primers are as follows: a sequence of a forward primer int1F is CATCGTCGTAGAGACGTCGG, and a sequence of a reverse primer Int1R is AGAACAAGCAGGCATCACGA. The invention provides the primers, probes, kit and method for detecting the staphylococcus aureus and the integron in the food. The kit is reasonable in ingredients and proportioning ratio, convenient in use and quick and accurate in detection; the method for detecting the staphylococcus aureus and the integron int1 in the food by the kit is simple, convenient and rapid in operation, low in cost and accurate in detection result.
Owner:INSPECTION AND QUARANTINE TECHNOLOGY CENTER ZHONGSHAN ENTRY EXIT INSPECTION AND QUARANTINE

Antibody for resisting staphylococcus aureus toxin and applications thereof

The invention discloses an antibody for resisting staphylococcus aureus toxin and applications thereof, and relates to the technical field of antibodies. According to the antibody or a fragment thereof which is specifically combined with staphylococcus aureus toxin, the antibody or the fragment thereof can be specifically combined with a staphylococcus aureus gamma-hemolysin H1gB component, and can generate a cross reaction with other hemolysin components of the the hemolysin. The antibody comprises a variable region of heavy chain (VH) and a variable region of light chain (VL), wherein the variable region of heavy chain (VH) comprises the following CDR combination: VH-CDR1, VH-CDR2 and VH-CDR3, and the variable region of light chain (VL) comprises the following CDR combination: VL-CDR1, VL-CDR2 and VL-CDR3. The present invention can exert the effect of neutralizing, at least including neutralizing H1gB two-component toxin, thereby achieving the treatment of staphylococcus aureus infection alone or in combination with anti-staphylococcus aureus chemical drugs.
Owner:SHANGHAI CHANGZHENG HOSPITAL

Kit and method for simultaneous detection of Staphylococcus aureus gene and Escherichia coli gene by using dual molecular beacon-LAMP process

The invention discloses a kit and a method for simultaneous detection of a Staphylococcus aureus gene and an Escherichia coli gene by using a dual molecular beacon-LAMP process, belonging to the technical field of molecular biological detection. The kit comprises an LAMP reaction system, wherein the LAMP reaction system comprises a primer group used for detecting the Staphylococcus aureus gene nuc and an rfbE gene of the Escherichia coli O157: H7, the primer group includes a pair of outer primers F3 and B3, a pair of inner primers FIP and BIP and a molecular beacon probe of the nuc gene and further includes a pair of outer primers F3 and B3, a pair of inner primers FIP and BIP and a molecular beacon probe of the rfbE gene. The method provided by the invention has the advantages of high sensitivity, strong specificity, avoidance of cross reaction with a dozen of bacteria of a control group, simple operation, realization of visual and clear observation of results and a fast detection speed.
Owner:SHAANXI UNIV OF SCI & TECH

Method of treating staphylococcus aureus infection

The present invention provides a method of preventing or treating bacteremia caused by Staphylococcus aureus, said method comprising administering a drug comprising a drug specific for one or more Staphylococcus aureus (S. aureus) antigens. Monoclonal or polyclonal antibody compositions of the antibodies. In a specific embodiment, the composition is a hyperimmune specific IGIV composition. In another specific embodiment, the composition comprises antibodies to capsular polysaccharide S. aureus antigens, such as type 5 and / or type 8 antigens. In another embodiment, the composition comprises a monoclonal antibody directed against a capsular polysaccharide S. aureus antigen. The method provides an effective means of preventing or treating S. aureus bacteremia, and it can be used alone or in combination with other therapies.
Owner:NABI BIOPHARMLS

Nasal, wound and skin formulations and methods for control of antibiotic-resistant staphylococci and other gram-positive bacteria

Formulations and methods are disclosed which are effective to kill or control bacteria in the nares including gram-positive bacteria strains of S. aureus that are antibiotic resistant (MRSA—methicillin-resistant Staphylococcus aureus. A preferred composition comprises one or more medium-chain alcohols (dodecanol), glycerol monoesters (glycerol monocaprylate or glycerol monolaurate), and / or benzoic acid or benzoic acid analog, in a suitable pharmaceutical carrier, preferably an ointment, along with an odorant compound, preferably eucalyptus oil. The formulations and variations of the formulation may also be used on open wounds or lesions as well as intact skin.
Owner:GUTHERY B EUGENE

A bovine-derived anti-staphylococcus aureus eukaryotic expression single chain antibody, a preparing method thereof and uses of the antibody

A bovine-derived anti-staphylococcus aureus eukaryotic expression single chain antibody, a preparing method thereof and uses of the antibody are disclosed. The eukaryotic expression single chain antibody at least comprises a bovine-derived single chain antibody segment VL-Linker-VH formed by connecting a bovine antibody light chain variable region VL having an amino acid sequence shown as SEQ ID No.1, a bovine antibody heavy chain variable region VH having an amino acid sequence shown as SEQ ID No.2, and a middle connecting peptide Linker according to a VL-Linker-VH order. After a coding gene of the segment is inserted into an eukaryotic expression vector to construct a single chain antibody eukaryotic expression plasmid pcDNA3.1-scFv, the pcDNA3.1-scFv is directly injected to a mouse mammary tissue, and therefore contents (P<0.05) of cell factors IFN-gamma and IL-4 can be significantly increased, the content of an inflammatory factor TNF-alpha (P<0.05) can be reduced, relative integrity of the mammary structure can be maintained, infiltration of inflammatory cells is reduced and a mouse is provided with certain protection.
Owner:SHANGHAI JIAO TONG UNIV

DNA-based methods for clone-specific identification of staphylococcus aureus

MRSA CC398 is a clone of S. aureus that has recently emerged in pigs and other domestic animals worldwide. As any other MRSA, the clone displays high levels of antibiotic resistance and poses a serious threat to human health because of the risk of antibiotic treatment failure in human patients. We developed a new diagnostic test for identification of MRSA CC398 using a single one-step PCR that is very easily performed within a few hours. The test is based on the principle that clonal differences within S. aureus are reflected in the sequence of a gene (sau1hsdS1) located on the chromosome of this bacterial species. Accordingly, such a gene represents an optimal target for S. aureus and MRSA identification at the clone level. The test includes detection of the gene conferring methicillin resistance (mecA), therefore allowing rapid discrimination between methicillin-susceptible and methicillin-resistant variants of the clone. A preliminary validation of the test was performed on a collection of CC398 and non-CC398 strains, resulting in 100% sensitivity and 100% specificity. The test can be combined to real-time PCR technology to further reduce simplify the test performance as well as to allow quantification of the target MRSA clone in biological specimens. The invention has important applications related to surveillance and control of MRSA CC398 in humans, animals and food products.
Owner:ST GEORGES HOSPITAL MEDICAL SCHOOL +2
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More