152 results about "Staphylococcus caprae" patented technology

The invention provides an Enterococcus faecium ANSE228 of which the collection number is CGMCC No.4082. The invention also provides application of the Enterococcus faecium ANSE228 to inhibition of salmonella pullorum and/or Escherichia coli and/or Staphylococcus aureus. The Enterococcus faecium ANSE228 is obtained by processes of repeated separation, purification, rejuvenation and the like, and has high biological activity, obvious probiotic property, high adversity resistance and the like. The invention also provides a microecological agent which contains the Enterococcus faecium ANSE228. When the microecological agent is added into drinking water and/or feeds for breeding animals, the Enterococcus faecium ANSE228 can be quickly activated and reproduced and a dominant beneficial flora can be formed after the Enterococcus faecium ANSE228 is fed into intestinal canals of the animals, and the Enterococcus faecium ANSE228 has the effects of reducing a harmful flora in the intestinal canals, adjusting microecological balance of the intestinal canals, substituting for medicaments such as antibiotic and the like, and improving weight increment of the animals and the utilization rate of the feeds.

The present invention relates to a novel bacteriophage, more precisely a Podoviridae bacteriophage having killing activity specific to Staphylococcus aureus which is the causing agent of infectious disease in human and animals, a pharmaceutical composition for the prevention and treatment of the disease caused by Staphylococcus aureus, an antibiotic and a disinfectant containing the bacteriophage as an active ingredient.

The invention relates to a bacteriophage and antimicrobial application thereof, in particular to a methicillin-resistant staphylococcus epidermidis staphylococcus aureus bacteriophage and antimicrobial application thereof, and belongs to the field of bioengineering. The methicillin-resistant staphylococcus epidermidis staphylococcus aureus bacteriophage is preserved in China Center for Type Culture Collection (CCTCC), located in Wuhan University of Wuhan of China, on September 17, 2015. The collection number is staphylococcus aureus bacteriophage qdsa002 of CCTCC M2015554. The Latin scientific name is staphylococcus aureus bacteriophage qdsa002. The bacteriophage has high splitting effect on staphylococcus aureus, especially methicillin-resistant staphylococcus epidermidis staphylococcus aureus. The preparation can be used individually or compounded with other drugs, and a safe bacteriophage product source free of toxic and side effects is provided for control of methicillin-resistant staphylococcus epidermidis staphylococcus aureus contamination.

The invention discloses an LAMP primer combination for detecting 6 infectious pathogens of dairy cow mastitis and application thereof. The invention first provides a primer combination consisting of 36 DNA molecules shown in sequence 1 to sequence 36. The primer combination can be used for detecting whether a to-be-detected bacterium is Mycoplasma bovis, Staphylococcus aureus, Streptococcus agalactiae, Streptococcus pyogenes, Corynebacterium bovis or Staphylococcus epidermidis, and can be used for detecting whether a to-be-detected sample contains Mycoplasma bovis and/or Staphylococcus aureusand/or Streptococcus agalactiae and/or Streptococcus pyogenes and/or Corynebacterium bovis and/or Staphylococcus epidermidis. The primer combination provided by the invention is used for identifying and detecting the 6 infectious pathogens of dairy cow mastitis, has high specificity and high sensitivity, and can realize simple, rapid and accurate detection, thus having great popularization value.

A method of preventing or treating staphylococcal bacterial infection in an individual is disclosed. A vaccine based on a conjugate the 336 polysaccharide antigen can be used for active protection in individuals who are to be subjected to conditions that place them at immediate risk of developing a bacterial infection, as would be case in the context of a catheterization or a surgical procedure. Alternatively, antibodies raised in response to the antigen can be used to treat or to provide passive protection to individuals. The method can be used in a population of patients at risk for infection by various species of Staphylococcus or various types of Staphylococcus aureus.

The invention belongs to the technical field of biomedicine, and in particular relates to the application of cathelicidin-BF, an antibacterial peptide of ceratopsia, in the preparation of medicines for treating bacterial vaginosis. The antibacterial peptide cathelicidin-BF of the present invention has the beneficial characteristics of strong bactericidal effect and rapid sterilization on Staphylococcus aureus and Escherichia coli in vitro; the effect of cathelicidin-BF on vaginitis caused by E. The results of coccus-infected vaginitis are basically the same, and it can significantly inhibit Staphylococcus aureus or Escherichia coli in the vagina, and cathelicidin-BF has an obvious effect of reducing inflammation; it can be used in the preparation of drugs for treating bacterial vaginosis.

The invention relates to a bovine-derived anti-staphylococcus aureus single-chain antibody. The antibody at least comprises a light chain variable region of an amino acid sequence which is represented in SEQ ID No.1, a heavy chain variable region of an amino acid sequence which is represented in SEQ ID No.2 and an intermediate connecting peptide which is located between the light chain variable region and the heavy chain variable region. The single-chain antibody can be specifically bound with staphylococcus aureus, has certain external neutralization activity and has good application prospects when used in related reagents or drugs for diagnosing, preventing and treating staphylococcus aureus bovine mastitis.

The invention discloses a staphylococcus aureus vaccine and a preparation method thereof. Staphylococcus aureus is inactivated through radiation and adjuvants are added, so that the proliferative activity of the staphylococcus aureus loses and the metabolic activity of the staphylococcus aureus is reserved; compared with thermal inactivation and inactivation with such chemicals as formaldehyde and the like, protein and polysaccharide antigens on the surface of the bacterium body (the staphylococcus aureus) can be well reserved, and immune response and immune protection can be comprehensively and obviously induced. The preparation method is simple and convenient and is suitable for the large-scale preparation of the staphylococcus aureus vaccine; the preparation method is not only suitable for preparing the staphylococcus aureus vaccine, but also capable of serving as a rapid response strategy of bio-threat or newly emerging pathogens; especially, for pathogens which are not clear in immune response mechanism, a candidate vaccine can be rapidly prepared by virtue of the method; and the method can shorten research and development time and can reduce research and development cost.

The invention belongs to the field of molecular biology and immunology. The invention relates to three truncated proteins of a staphylococcus aureus iron regulation surface determining protein B (IsdB) and a staphylococcus aureus alpha-hemolysin (Hla) attenuated protein, and their coding genes, preparation method and use. The invention also relates to the combined use of the three truncated proteins and the alpha-hemolysin attenuated body.

The invention discloses a method of detecting salmonella, shigella and staphylococcus aureus, which includes the following steps: 1) mixing a to-be-tested sample with a liquid culture medium and performing cultivation to the mixture under a condition which enables bacteria possibly existing in the to-be-test sample to be amplified to obtain an amplified sample; 2) capturing the salmonella, the shigella and the staphylococcus aureus, which possibly exist in the amplified sample, by means of immunomagnetic beads which are prepared through coupling of an antibody and magnetic spheres; 3) extracting the genome DNA of the bacteria captured in the step 2); and 4) with a specific primer aiming to the salmonella, the shigella and the staphylococcus aureus, performing multiple fluorescent quantitative PCR to the extracted genome DNA to determine the existence of the salmonella, the shigella and the staphylococcus aureus in the to-be-tested sample. The method achieves simultaneous detection of the salmonella, the shigella and the staphylococcus aureus, is high in sensitivity and is accurate in result.

The invention relates to the technical field of medicine, and provides application of luteolin in a bacterial quorum sensing inhibition system, application of luteolin in preparing drug for lowering pathogenicity of staphylococcus aureus virulence factors and application of luteolin in preparing drug for inhibiting transcription of hla and agrA genes of staphylococcus aureus. Minimum effective concentration with application value is provided for the application of luteolin in the bacterial quorum sensing inhibition system, and a reference is provided for medically preparing specific bio-film forming inhibitors. The invention further provides a drug combination for inhibiting formation of staphylococcus aureus bio-films. The drug combination contains luteolin. According to the drug combination, formation of the bio-films of staphylococcus aureus can be inhibited by effectively inhibiting a quorum sensing system of staphylococcus aureus through tiny luteolin, prognosis risk, of staphylococcus aureus, for infection with high-drug-tolerance bio-films in anti-infection treatment is lowered, and a valuable reference is provided for medically preparing specific preparations for inhibiting the staphylococcus aureus bio-films.

The invention provides a fusion protein SIP-TRAP and a preparation method and use thereof. The fusion protein SIP-TRAP is obtained inserting a fusion gene formed by connecting the SIP gene of streptococcus agalactiae and the TRAP gene of staphylococcus aureus into a vector and performing expression and purification. Experiments indicate the protein has high immunogenicity and that the immune effect of the protein is better that that of SIP and TRAP alone and that of the combination of SIP and TRAP. The SIP-TRAP protein provided by the invention can serve as an immunogen to improve the resistance of cow or sheep to infection with streptococcus agalactiae and staphylococcus aureus, simplifies the process of immune operation and has good immune effect.

The invention discloses a screening method for clostridium butyricum producing efficient antibacterial peptide butyrisin. The method includes the following steps in order: 1) performing preliminary screening based on the bacteriostatic activity of a fermentation bacterial broth: taking Escherichia coli and Staphylococcus aureus as the indicator bacteria to perform preliminary screening on to-be-tested strains, thus obtaining clostridium butyricum having antibacterial activity on Escherichia coli and Staphylococcus aureus; and 2) verifying the expression of antibacterial peptide butyrisin protein gene by PCR. The PCR positive strain is clostridium butyricum producing efficient antibacterial peptide butyrisin. By the method provided by the invention, the clostridium butyricum producing efficient antibacterial peptide butyrisin can be obtained. The antibacterial peptide has antibacterial activity on bacteria including but not limited to E.coli ATCC25922, E.coli K88, S.aureus ATCC25923 and the like.

The invention discloses primers, probes, a kit and a method for detecting staphylococcus aureus and integron int1 in food. The primers comprise staphylococcus aureus primers and integron primers; sequences of the staphylococcus aureus primers are as follows: a sequence of a forward primer SAF is ATTCCGGATAACGCTTGCCA, and a sequence of a reverse primer SAR is AGGGAATCTTCCGCAATGGG; sequences of the integron primers are as follows: a sequence of a forward primer int1F is CATCGTCGTAGAGACGTCGG, and a sequence of a reverse primer Int1R is AGAACAAGCAGGCATCACGA. The invention provides the primers, probes, kit and method for detecting the staphylococcus aureus and the integron in the food. The kit is reasonable in ingredients and proportioning ratio, convenient in use and quick and accurate in detection; the method for detecting the staphylococcus aureus and the integron int1 in the food by the kit is simple, convenient and rapid in operation, low in cost and accurate in detection result.

The invention discloses an antibody for resisting staphylococcus aureus toxin and applications thereof, and relates to the technical field of antibodies. According to the antibody or a fragment thereof which is specifically combined with staphylococcus aureus toxin, the antibody or the fragment thereof can be specifically combined with a staphylococcus aureus gamma-hemolysin H1gB component, and can generate a cross reaction with other hemolysin components of the the hemolysin. The antibody comprises a variable region of heavy chain (VH) and a variable region of light chain (VL), wherein the variable region of heavy chain (VH) comprises the following CDR combination: VH-CDR1, VH-CDR2 and VH-CDR3, and the variable region of light chain (VL) comprises the following CDR combination: VL-CDR1, VL-CDR2 and VL-CDR3. The present invention can exert the effect of neutralizing, at least including neutralizing H1gB two-component toxin, thereby achieving the treatment of staphylococcus aureus infection alone or in combination with anti-staphylococcus aureus chemical drugs.

MRSA CC398 is a clone of S. aureus that has recently emerged in pigs and other domestic animals worldwide. As any other MRSA, the clone displays high levels of antibiotic resistance and poses a serious threat to human health because of the risk of antibiotic treatment failure in human patients. We developed a new diagnostic test for identification of MRSA CC398 using a single one-step PCR that is very easily performed within a few hours. The test is based on the principle that clonal differences within S. aureus are reflected in the sequence of a gene (sau1hsdS1) located on the chromosome of this bacterial species. Accordingly, such a gene represents an optimal target for S. aureus and MRSA identification at the clone level. The test includes detection of the gene conferring methicillin resistance (mecA), therefore allowing rapid discrimination between methicillin-susceptible and methicillin-resistant variants of the clone. A preliminary validation of the test was performed on a collection of CC398 and non-CC398 strains, resulting in 100% sensitivity and 100% specificity. The test can be combined to real-time PCR technology to further reduce simplify the test performance as well as to allow quantification of the target MRSA clone in biological specimens. The invention has important applications related to surveillance and control of MRSA CC398 in humans, animals and food products.