Kit and method for detecting staphylococcus aureus and integron in food
A staphylococcus aureus and aureus technology, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, and microbial determination/inspection, can solve the problems of staphylococcus aureus and integron detection that have not been reported, and achieve good industry Prospect of chemicalization, rapid detection, reasonable composition and proportioning effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] The present invention detects the primers and probes of Staphylococcus aureus and integron int1 in food, and the sequences of the primers and probes are respectively:
[0051] Upstream primer SAF: ATTCCGGATAACGCTTGCCA
[0052] Downstream primer SAR: AGGGAATCTTCCGCAATGGG
[0053] Probe SAP: GCGGCGTTGCTCCGTCA
[0054] Upstream primer int1F: CATCGTCGTAGAGACGTCGG
[0055] Downstream primer Int1R: AGAACAAGCAGGCATCACGA
[0056] Probe Int1P: AGGGTGTGCGGTGTGGCGGGC
Embodiment 2
[0058] The present invention is a test kit for detecting Staphylococcus aureus and integron int1 in food, wherein 20 wherein the reaction system comprises the following components:
[0059] 2×ddPCR Super Mix 10.0 μL, Staphylococcus aureus and int1 forward and reverse primers 1.0 μL each, probe 1.0 μL each, DNA template 4.0 μL.
[0060] Wherein the sequences of primers and probes are as follows:
[0061] Upstream primer SAF: ATTCCGGATAACGCTTGCCA
[0062] Downstream primer SAR: AGGGAATCTTCCGCAATGGG
[0063] Probe SAP: GCGGCGTTGCTCCGTCA
[0064] Upstream primer int1F: CATCGTCGTAGAGACGTCGG
[0065] Downstream primer Int1R: AGAACAAGCAGGCATCACGA
[0066] Probe IntlP: AGGGTGTGCGGTGTGGCGGGC.
Embodiment 3
[0068] The method for detecting Staphylococcus aureus and integron int1 in food of the present invention comprises the following steps:
[0069] A. Extract sample DNA;
[0070] Add each reaction component to a 20.0 μl reaction system, then add 70.0 μl mineral oil, mix well and transfer to a droplet generator to automatically generate droplets; the 20.0 μl reaction body includes 10.0 μL of 2×ddPCR Super Mix, golden yellow Staphylococcus and int1 forward and reverse primers 1.0 μL each, probe 1.0 μL each, DNA template 4.0 μL.
[0071] B. Carefully transfer all the generated micro-droplets to the PCR reaction tube of the 96-well reaction plate; then seal the 96-well reaction plate on a film sealing machine, and place it in an ordinary PCR machine for PCR reaction.
[0072] C. Open the application software of the droplet fluorescence detector, insert the 96-well reaction plate after the PCR reaction directly into the device, detect the PCR reaction of the droplet in each PCR reac...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com