Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

513 results about "Thiophosphate" patented technology

Thiophosphates (or phosphorothioates, PS) are chemical compounds and anions with the general chemical formula PS₄₋ₓO³⁻ₓ (x = 0, 1, 2, or 3) and related derivatives where organic groups are attached to one or more O or S. Thiophosphates feature tetrahedral phosphorus(V) centers.

Compositions comprising cyclic purine dinucleotides having defined stereochemistries and methods for their preparation and use

It is an object of the present invention to provide novel and highly active cyclic-di-nucleotide (CDN) immune stimulators that activates DCs via a recently discovered cytoplasmic receptor known as STING (Stimulator of Interferon Genes). In particular, the CDNs of the present invention are provided in the form of a composition comprising one or more cyclic purine dinucleotides that induce STING-dependent TBK1 activation, wherein the cyclic purine dinuclotides present in the composition are substantially pure Rp,Rp or Rp,Sp stereoisomers, and particularly substantially pure Rp,Rp, or RpSp CDN thiophosphate diastereomers.
Owner:CHINOOK THERAPEUTICS INC

TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications

A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
Owner:THE UNIV OF BRITISH COLUMBIA

Compositions comprising cyclic purine dinucleotides having defined stereochemistries and methods for their preparation and use

It is an object of the present invention to provide novel and highly active cyclic-di-nucleotide (CDN) immune stimulators that activates DCs via a recently discovered cytoplasmic receptor known as STING (Stimulator of Interferon Genes). In particular, the CDNs of the present invention are provided in the form of a composition comprising one or more cyclic purine dinucleotides that induce STING-dependent TBK1 activation, wherein the cyclic purine dinuclotides present in the composition are substantially pure Rp,Rp or Rp,Sp stereoisomers, and particularly substantially pure Rp,Rp, or RpSp CDN thiophosphate diastereomers.
Owner:CHINOOK THERAPEUTICS INC

Metal copper nano granules, its preparation method and application

The present invention discloses a kind of metal copper nano particles compound as multifunctional lubricant additive. Its preparation method includes the following steps: using organic compound containing thiophosphate as modifying agent and making it react with soluble cupric acetate for 2-12 hr. at 50-80 deg.c in the presence of reaction medium hydrated hydrazine so as to obtain the invented product.
Owner:LANZHOU INST OF CHEM PHYSICS CHINESE ACAD OF SCI +1

Phosphorus-containing stabilizers for fluoroolefins

The present disclosure relates to compositions comprising at least one fluoroolefin and an effective amount of a stabilizer comprising at least one phosphorus-containing compound selected from the group consisting of thiophosphates, butylated triphenylphosphorothionates, and organophosphates. The stabilized compositions may be useful in cooling apparatus, such as refrigeration, air-conditioning, chillers and heat pumps, as well as in applications as foam blowing agents, solvents, aerosol propellants, fire extinguishants, and sterilants.
Owner:THE CHEMOURS CO FC LLC

Sensors with variable response behavior

A sensor and method for detecting biological and chemical agents comprising metal interdigitized electrodes coated with hybrid polymer-based conducting film and an instrument for applying electrical voltage to the electrodes and registering the change in electrical current. The hybrid film also comprises indicator biomolecules encapsulated within the film or attached to it. The bioindicator molecules preferably comprise enzyme acetylcholinesterase. When these indicator biomolecules come in a contact with a pathogen, chemical and / or morphological changes occur in the film and electrical current flowing through the electrodes is modulated. The pathogen comprise inhibitors of enzymes, preferably organophosphates, thiophosphates or phosphonates. The change in current indicates the presence of a biological and chemical agent and is registered.
Owner:HRL LAB

Petroleum-engine oil composition and application thereof

The invention relates to a petroleum-engine oil composition and application thereof, and mainly aims to solve the problem of poor wear resistance of petroleum and engine oil existing in the prior art. The problem is well solved by adopting the technical scheme that the petroleum-engine oil composition comprises the following components in parts by weight: (a) 1-20 pars of a detergent, a dispersant or a mixture thereof, (b) 0.5-15 parts of an anti-oxygen wear-resistant agent, (c) 1-20 parts of a viscosity index modifier, (d) 0.01-5 parts of a pour point depressant, (e) 0.001-3 parts of an anti-foaming agent, and (f) 60-95 parts of base oil, wherein the anti-oxygen wear-resistant agent is selected from at least one of 2,6-di-tert-butyl-4-methylphenol, 2,6-di-tert-butyl mixed phenol, alkylated arylamine, zinc butyl octyl dithiophosphate, base zinc salt of dioctyl thiophosphate, di(octadecyl)-3,3-thiodipropionate, zinc(II)dibutyl dithiocarbamate, thiadiazole, molybdenum dithiocarbamate or molybdenum dialkyldithiophosphat. The petroleum-engine oil composition can be applied to industrial production of the petroleum-engine oil composition.
Owner:CHINA PETROLEUM & CHEM CORP

Low sulfur and low phosphorus heavy duty diesel engine lubricating oil composition

ActiveUS20070111905A1Reduce the temperatureGuaranteed low temperature fluidityAdditivesAnti oxidantHeavy duty diesel
The present invention is directed to a low sulfur and low phosphorus heavy duty diesel engine lubricating oil composition comprising (a) a major amount of an oil of lubricating viscosity and (b) one or more dispersants (c) one or more anti-oxidants and (d) one or more ash-containing detergents, wherein the lubricating oil composition is essentially free of zinc di-alkyl di-thiophosphates and contains no more than 0.175 weight percent sulfur and provided the lubricating oil composition does not contain alkylated and non-alkylated aromatic amines and tri-nuclear molybdenum compounds. The present invention is also directed to a low sulfur and low phosphorus heavy duty diesel engine lubricating oil composition comprising (a) an oil of lubricating viscosity (b) a borated dispersant and a non-borated dispersant (c) a molybdenum anti-oxidant and a phenolic anti-oxidant and (d) a low overbased calcium sulfonate and a high overbased calcium phenate, wherein the lubricating oil composition is essentially free of zinc di-alkyl di-thiophosphates and contains no more than 0.175 weight percent sulfur and provided the lubricating oil composition does not contain alkylated and non-alkylated aromatic amines and tri-nuclear molybdenum compounds. The present invention is also directed to method for lubricating a heavy duty diesel engines, which comprises lubricating the engine with a low sulfur and low phosphorus heavy duty diesel engine lubricating oil compositions of the present invention.
Owner:CHEVRON ORONITE CO LLC

Micro quantity lubrication system aluminum alloy cutting fluid, and preparation and use thereof

The invention belongs to the technical field of cutting fluid, in particular to an aluminum alloy cutting fluid of a micro-lubricating system as well as a preparation method and usage thereof. The aluminum alloy cutting fluid of a micro-lubricating system is prepared by the materials with the following weight percentage: 30 percent of base oil, 5 to 20 percent of sulfurized isobutene, 5 to 20 percent of chlorcosane, 5 to 20 percent of thiophosphate, 5 to 20 percent of potassium borate, 10 percent of surface activator as well as 5 percent of antirusting agent; mineral oil or plant oil is used as the base oil. Compared with the prior art, the aluminum alloy cutting fluid of a micro-lubricating system has excellent lubricity and heat radiation; the dosage is reduced below 5 percent of the original dosage; besides, the drainage pollution to rivers, lakes and seas is reduced, the processing cost is saved and the lubricating effect is improved.
Owner:SHANGHAI JINZHAO ENERGY SAVING TECH

Thiol-containing compounds for the removal of elements from contaminated milieu and methods of use

Sulfur-containing ligands and methods of their utilization for binding metals and / or main group elements and removing them from fluids, solids, gases and / or tissues are disclosed. The ligands are of the general structure:where R1 comprises benzene, pyridine, pyridin-4-one, naphthalene, anthracene, phenanthrene or alkyl groups, R2 comprises hydrogen, alkyls, aryls, a carboxyl group, carboxylate esters, organic groups or biological groups, R3 comprises alkyls, aryls, a carboxyl group, carboxylate esters, organic groups or biological groups, X comprises hydrogen, lithium, sodium, potassium, rubidium, cesium, francium, alkyls, aryls, a carboxyl group, carboxylate esters, thiophosphate, N-acetyl cysteine, mercaptoacetic acid, mercaptopropionic acid, thiolsalicylate, organic groups or biological groups, n independently equals 1-10, m=1-6, Y comprises hydrogen, polymers, silicas or silica supported substrates, and Z comprises hydrogen, alkyls, aryls, a carboxyl group, carboxylate esters, a hydroxyl group, NH2, HSO3, halogens, a carbonyl group, organic groups, biological groups, polymers, silicas or silica supported substrates.
Owner:HALEY BOYD E +1

Phosphorus-containing stabilizers for fluoroolefins

The present disclosure relates to compositions comprising at least one fluoroolefin and an effective amount of a stabilizer comprising at least one phosphorus-containing compound selected from the group consisting of thiophosphates, butylated triphenylphosphorothionates, and organophosphates. The stabilized compositions may be useful in cooling apparatus, such as refrigeration, air-conditioning, chillers and heat pumps, as well as in applications as foam blowing agents, solvents, aerosol propellants, fire extinguishants, and sterilants.
Owner:THE CHEMOURS CO FC LLC

Method for stabilization processing refuse incineration flying ash

The invention relates to a method capability of stabilizing the burnt ash in the garbage, belonging to the technical field of environmental engineering. The invention is characterized in that: dialkyl dithiophosphate compounds or dialkyl dithiophosphate compounds added with flocculants are used as the stabilizing agent; the stabilizing agent is dissolved in water, making a solution; then the solution is added by the burnt ash and mixed evenly, forming a condensed mixer; the mixture is buried after dried naturally. The weight ratio of the dialkyl dithiophosphate compounds to the flocculants in the stabilizing agent is 100:4 to 100:10; the weight ratio of the dialkyl dithiophosphate compounds to the burnt ash in the garbage is 0.5:100 to 3:100, and the weight ratio of water to the ash is 0.7 to 1.0:1. The invention has the advantages that: the chelating ability of the dialkyl dithiophosphate compounds with the heavy metal ions is strong; the price is low; the leaching concentration of the ash after the stabilization under pH1 to 13 can meet the identification standards of hazardous wastes, and secondary pollution is not caused.
Owner:HOHAI UNIV

Special slow control/release compound fertilizer for eggplant and preparation method thereof

The invention provides a special slow control / release fertilizer for an eggplant. The fertilizer is characterized by comprising, in terms of mass percent, 0.05% to 0.08% of n-butyl triamine thiophosphate, 0.05 to 0.08% of hydroquinone and 0.24 to 0.28% of dicyandiamide. According to the invention, the special slow control / release fertilizer is prepared by combining macro-element, medium-element and trace-element fertilizers like nitrogen, phosphorus, potassium, calcium, magnesium, molybdenum, boron, zinc and iron with organic fertilizers like high-quality decomposed rapeseed dregs, chicken manure and grass carbon, adding a urease inhibitor and a nitrification inhibitor and carrying out mixing; the special slow control / release fertilizer has a slow release effect in soil, is rich in a variety of nutrient elements needed in growth of the eggplant, can meet demands of the eggplant for nutrients in different growth and development phases for a long time and effectively improves output of the eggplant.
Owner:SOUTHWEST UNIVERSITY

Micro quantity lubrication system aluminum alloy lubricant, and preparation and use thereof

The invention belongs to the technical field of lubricant, in particular to an aluminum alloy lubricant of a micro-lubricating system as well as a preparation method and usage thereof. The aluminum alloy lubricant of a micro-lubricating system is prepared by the materials with the following weight portions: 40 portions of base oil, 5 to 15 portions of thiophosphate, 5 to 15 portions of chlorcosane, 5 to 15 portions of sulfurized isobutene, 5 to 15 portions of potassium borate, 5 to 10 portions of ethanol or glycol as well as 5 portions of antirusting agent; mineral oil or plant oil is used as the base oil. Compared with the prior art, the total amount of the extreme pressure antiwear additives including the thiophosphate, the chlorcosane, the sulfurized isobutene and the potassium borate exceeds the content of the base oil, thus leading the product to have excellent lubricity; the ethanol or glycol is used to lead the product to have excellent heat radiation and lead the dosage of the lubricant to be reduced below 5 percent of the original dosage, reduce the drainage pollution to rivers, lakes and seas, save the processing cost and improve the lubricating effect.
Owner:SHANGHAI JINZHAO ENERGY SAVING TECH

Reagent kit for quantitatively assessing long-term recurrence risks of breast cancer

The invention relates to the functional genomic and gene expression detection technology and the analysis technology, and discloses a reagent kit for quantitatively assessing long-term recurrence risks of breast cancer. Particularly, a type of genes capable of being used for breast cancer metastasis and prognostic molecular classification is screened within a human functional genome expression profile range, the detection technology is created, and the reagent kit is prepared and applied to breast cancer metastasis and prognostic assessment for a patient. The reagent kit for quantitatively assessing long-term recurrence risks of breast cancer comprises 21 pairs of primers, 21 specific taqman fluorescent probes, 10XRT-PCR (reverse transcription-polymerase chain reaction) buffer solution, 2.5mM of dNTP (diethyl-nitrophenyl thiophosphate) mixed liquor, reverse transcriptase, DNA (deoxyribose nucleic acid) polymerase, 10XPCR buffer solution and RNA (ribonucleic acid) enzyme inhibitor. The reverse transcription PCR technology is combined with the taqman fluorescent quantitative PCR technology, reverse transcription primers, real-time PCR primers and the taqman fluorescent probes are self-designed and optimized, reverse transcription PCR reagent and taqman fluorescent quantitative PCR reagent are integrated to prepare the detection reagent kit, operation is simple and fast, detection results are more stable, and detection cost is lower.
Owner:苏州科贝生物技术有限公司

Acid-resistance promoting composition

A composition for providing acid resistance to copper surfaces in the production of multilayered printed circuit boards. The composition comprises an acid, an oxidizer, a five-membered heterocyclic compound and a thiophosphate or a phosphorous sulfide compound. In a preferred embodiment, the phosphorous compound is phosphorus pentasulfide. The composition is applied to a copper or copper alloy substrate and the copper substrate is thereafter bonded to a polymeric material.
Owner:MACDERMID ACUMEN INC

Polyurea-based grease additive composition

The invention relates to a polyurea-based grease additive composition. Components and percentage content of the polyurea-based grease additive composition are that: base oil is mineral oil and synthetic oil or blending oil of the mineral oil and the synthetic oil, and the content of the base oil is from 71% to 91.5%; a thickening agent is composed of a common reactant of isocyanate, fatty amine and alicyclic amine, and the content of the thickening agent is from 6% to 12%; an antioxidant uses amine antioxidants, and the total content of the antioxidant is from 0.5% to 3%; an extreme-pressure agent uses a mixture of sulfurized isobutylene, dialkyl group dithiophosphate and dialkyl group dithiocarbamic acid, and the total content of the extreme-pressure agent is from 0.5% to 5%; the content of an antirusting agent is from 0.5% to 3%; an antiwear agent is triphenyl thiophosphate and thiophosphoric acid ester or a mixture of the triphenyl thiophosphate and the thiophosphoric acid ester, and the total content of the antiwear agent is from 0.5% to 3%; and tackifier is polyisobutene and polymethyl methacrylate or a mixture of the polyisobutene and the polymethyl methacrylate, and the total content of the tackifier is from 0.5% to 3%. Due to the fact that appropriate raw material proportion is selected and used, grease has good high-temperature performance, a dropping point is higher than 260 DEG C, and the polyurea-based grease additive composition has a good water-resisting property, high and low temperature resistance and extreme pressure anti-wear performance, and can be applied to lubrication of each key running part of a continuous casing machine.
Owner:CHINA PETROLEUM & CHEM CORP

Dithiophosphate composition and utility in rubber

The present invention relates to oligomeric or polymer dithiophosphate di- or poly- sulfides and their utility in rubbers. Another aspect of the invention is a method for making oligomeric or polymeric dithiophosphates by reacting phosphorous pentasulfide with a di- or polyol and a mono alcohol to produce a dithiophosphoric acid, and then oxidizing the dithiophosphoric acid with an oxidizing agent to produce an oligomeric or polymeric dithiophosphate.
Owner:VANDERBILT CHEM LLC

Organic thiophosphate antiretroviral agents

A method for the prevention or treatment of human immunodeficiency virus infection by administering an effective amount of amifostine, phosphonol, or similar compound to an individual in need is provided.
Owner:US DEPT OF HEALTH & HUMAN SERVICES +1

Thiophosphates and thiophosphate derivatives as lubricant additives

The present invention provides thiophosphates and thiophosphate derivatives useful as antiwear additive components, lubricant additive compositions and lubricant compositions each comprising such compounds, and methods for making and using the same. In one aspect, the invention relates to a compound of formula (I):or a tribologically acceptable salt thereof.
Owner:AFTON CHEMICAL

Production method of unleaded gasoline for vehicle

The invention discloses a production method of unleaded gasoline for a vehicle, wherein the unleaded gasoline is prepared from the following raw materials in parts by weight: 35-65 parts of methanol, 60-30 parts of gasoline, 2-4 parts of isobutyl alcohol, 1-3 parts of acetone, 2-4 parts of methyl tertiary butyl ether, 2-5.5 parts of toluene or dimethyl benzene, 0.01-0.03 part of methyl cyclopentadienyl manganese tricarbonyl, 0.03-0.1 part of butyl octyl zinc thiophosphate and 0.1-3 parts of dicyclopentadienyl iron; the unleaded gasoline is prepared by the method comprising the following steps of: sequentially adding the acetone, the toluene or the dimethyl benzene, the isobutyl alcohol, the methyl tertiary butyl ether, the butyl octyl zinc thiophosphate, the dicyclopentadienyl iron and the methyl cyclopentadienyl manganese tricarbonyl as the raw materials into a container at normal temperature and under normal pressure, fully stirring to obtain a yellow transparent liquid, then adding the yellow transparent liquid into the methanol and fully stirring to obtain modified methanol; adding the modified methanol liquid into the gasoline and uniformly stirring to obtain a finished product. The invention has the advantages of low cost, low pollution, low oil consumption, low corrosion and high power, and each item index of the invention exceeds that of the traditional gasoline.
Owner:刘超

Total synthesis water-base cutting fluid for sintering neodymium-iron-boron and preparation method thereof

The invention relates to a full synthetic water-based cutting fluid for sintering NdFeB. The invention is made of raw materials with the following weight percentage: monocarboxylic acid or dicarboxylic acid of 2 to 9 percent; at least one of triethanolamine or diethanolamine of 2 to 20 percent; water-soluble thiophosphate of 0.1 to 2 percent; water-soluble rare earth complex of 0.1 to 2 percent; at least one of polyethylene glycol, polyvinyl alcohol and polypropylene glycol with the molecular weight of 200 to 600 of 2 to 20 percent; pH stabilizer of 0.01 to 0.1 percent; hard water resistant agent of 0.01 to 0.1 percent; water is the remaining. The preparation method is that: a. the required raw materials are added according to the raw material compositions; b. the mixture is heated, stirred and returned, the heating temperature is between 70 and 150 DEG C, the stirring speed is between 100 and 1000 r / min; c. after the reaction of 1 hour to 8 hours, the mixture is cooled to the room temperature. The cutting fluid has low cost as well as long lasting and antibacterial environmental protection, and has good cutting, cooling, lubricating and anti-rust functions to the NdFeB.
Owner:NINGBO INST OF TECH ZHEJIANG UNIV ZHEJIANG

Grease for motor bearings of wind generators and production method thereof

ActiveCN102433194AInhibition of catalysisInhibit high temperature corrosionLubricant compositionThiocarbamateCarbamate
The invention relates to the field of lubricating grease, in particular to grease for motor bearings of wind generators and a production method thereof. The grease is characterized by being prepared by blending the following components in part by weight: 9 to 13.5 parts of 12-hydroxystearic acid, 3 to 4.5 parts of sebacic acid, 2.6 to 3.9 parts of lithium hydroxide, 70 to 80.7 parts of base oil, 1 to 5 parts of extreme pressure additive, 0.5 to 2 parts of antioxygen, 0.5 to 2 parts of antirust additive, and 0.3 to 0.5 part of metal passivating agent. The base oil is mixed oil of hexane diacidisotridecyl alcohol ester, polyalphaolefin10 (PAO10), PAO40 and alkyl naphthalene. The extreme pressure additive is a mixture of thiocarbamate, triphenyl thiophosphate, molybdenum oxothioxo carbamates, and nano calcium carbonate. Compared with the prior art, the grease has the advantages of wide use temperature range, high waterproof and anticorrosion performance, high loading capacity, high wear-reducing and noise-reducing performance, very high low-temperature startability and very high lubricating performance.
Owner:辽宁海华科技股份有限公司

Composite flame retardant for polyesters and application method thereof

The invention relates to a composite flame retardant for polyesters and an application method thereof. The flame retardant is prepared through compounding any one of melamine cyanurate (MCA), melamine polyphosphate (MPP) and aluminium diethyl hypophosphite (1240) with bis(1-oxyphospha-2,6,7-trioxa bicyclo[2.2.2]octyl-4-methyl) phenyl thiophosphate (PPS-PEPA) in any weight preparation. The flame retardant disclosed by the invention has the advantages of multielement synergy, good material compatibility, high flame retardancy, environmental friendliness, and capability of reducing the application costs and the like.
Owner:BEIJING KEYING JINGYI TECH

Lubricant additive compositions containing thiophosphates and thiophosphate derivatives

The invention relates to thiophosphates and derivatives thereof useful as antiwear additive components, lubricant additive compositions and lubricant compositions each comprising such compounds, methods for making and using the same, including methods of lubricating machines and machine parts and methods of extending the useful life of elastomeric seal components of such machines. In one aspect, the invention relates to a lubricant additive composition comprising a compound of formula (I):or a tribologically acceptable salt thereof, and a sulfonate or a phenate detergent.
Owner:AFTON CHEMICAL

Hot-rolled oil composition containing organosilicon antiwear slip-proofing agent

The invention discloses a hot-rolled composition with organic silicon anti-friction antilubricant, which comprises the following parts: (I) lubricant basic oil with viscosity at 5-300mm2 / s at 40 deg.c, (II) 0.1-20wt% sulphur extreme pressure agent with one or more material from alkyl polysulfide, sulfur ore oil and sulfur polyol ester, (III) 0.05-15wt% phosphorus antiwear agent with one or more material from phosphate, phosphonate, phosphite ester, acid phosphate ester, phosphite ester amine salt, phosphamide ester, dialkyl dithiophosphate, dimercaptothiodiazole dithiophosphate ester and acid phosphate imidazoline salt, (IV) 0.001-25% organosilicon abrasion resistance antilubricant with silicon chloride, C2-16 aliphatic amine, disperser and non-ionic surface activator.
Owner:CHINA PETROLEUM & CHEM CORP +1

Method for preparing special lubricating grease and thickening agent for cylinder of electric tool

The invention relates to a method for preparing special lubricating grease and thickening agent for a cylinder of an electric tool. The lubricating grease and thickening agent mainly comprise the following components: a) base oil; b) at least one thickening agent of compound lithium, compound lithium calcium or carbamido grease, or composite thickening agent of any two of the three substances; c) silicon-containing anti-foaming agent; d) one or more extreme-pressure antiwear agents of borates or vulcanized whale oil substitute; e) one or more anilines antioxygens or dialkyldithiophosphates antioxygens; and f) tripolycyanamide urate; wherein the amount of the base oil in use accounts for 70-95% of the total weight of the lubricating grease, the thickening agent accounts for 5-30% of the total weight of the lubricating grease, the amount of the silicon-containing anti-foaming agent accounts for 5-10% of the total weight of the lubricating grease, the amount of the extreme-pressure antiwear agents accounts for 2-5% of the total weight of the lubricating grease, the amount of the antioxygens accounts for 1-5% of the total weight of the lubricating grease, and the amount of the tripolycyanamide urate accounts for 3-15% of the total weight of the lubricating grease. The lubricating grease, rubber and thermoplastic elastomer which are prepared using the components have good compatibility, excellent extreme-pressure wearability, foaming resistance, lubrication, flame resistance and noise lowering, and the like. The lubricating grease is suitable for the lubrication of the cylinders of various electric hammers and electric picks and in particular suitable for the lubrication and sealing of the cylinders of the electric hammers and electric picks which keeps on operating for a long time at a high speed.
Owner:杭州得润宝油脂股份有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More