Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

1558 results about "Methyl Donors" patented technology

S-adenosylmethionine is the methyl group donor for DNA methylation and several nutrients are required for the production of S-adenosylmethionine. These methyl nutrients include vitamins (folate, riboflavin, vitamin B12, vitamin B6, choline) and amino acids (methionine, cysteine, serine, glycine).

Xylo-LNA analogues

Based on the above and on the remarkable properties of the 2′-O,4′-C-methylene bridged LNA monomers it was decided to synthesise oligonucleotides comprising one or more 2′-O,4′-C-methylene-β-D-xylofuranosyl nucleotide monomer(s) as the first stereoisomer of LNA modified oligonucleotides. Modelling clearly indicated the xylo-LNA monomers to be locked in an N-type furanose conformation. Whereas the parent 2′-deoxy-β-D-xylofuranosyl nucleosides were shown to adopt mainly an N-type furanose conformation, the furanose ring of the 2′-deoxy-β-D-xylofuranosyl monomers present in xylo-DNA were shown by conformational analysis and computer modelling to prefer an S-type conformation thereby minimising steric repulsion between the nucleobase and the 3′-O-phopshate group (Seela, F.; Wömer, Rosemeyer, H. Helv. Chem. Acta 1994, 77, 883). As no report on the hybridisation properties and binding mode of xylo-configurated oligonucleotides in an RNA context was believed to exist, it was the aim to synthesise 2′-O,4′-C-methylene-β-D-xylofuranosyl nucleotide monomer and to study the thermal stability of oligonucleotides comprising this monomer. The results showed that fully modified or almost fully modified Xylo-LNA is useful for high-affinity targeting of complementary nucleic acids. When taking into consideration the inverted stereochemistry at C-3′ this is a surprising fact. It is likely that Xylo-LNA monomers, in a sequence context of Xylo-DNA monomers, should have an affinity-increasing effect.
Owner:QIAGEN GMBH

Method for producing complex DNA methylation fingerprints

Method for characterizing, classifying and differentiating tissues and cell types, for predicting the behavior of tissues and groups of cells, and for identifying genes with changed expression. The method involves obtaining genomic DNA from a tissue sample, the genomic DNA subsequently being subjected to shearing, cleaved by means of a restriction endonuclease or not treated by either one of these methods. The base cytosine, but not 5-methylcytosine, from the thus-obtained genomic DNA is then converted into uracil by treatment with a bisulfite solution. Fractions of the thus-treated genomic DNA are then amplified using either very short or degenerated oligonucleotides or oligonuclcotides which are complementary to adaptor oligonucleotides that have been ligated to the ends of the cleaved DNA. The quantity of the remaining cytosines on the guanine-rich DNA strand and / or the quantity of guanines on the cytosine-rich DNA strand from the amplified fractions are then detected by hybridization or polymerase reaction, which quantities are such that the data generated thereby and automatically applied to a processing algorithm allow the drawing of conclusions concerning the phenotype of the sample material.
Owner:EPIGENOMICS AG

1h-Indazole-3-carboxamide compounds as cyclin dependent kinase (cdk) inhibitors

The invention provides a compound of the formula (I) for use in the prophylaxis or treatment of a disease state or condition mediated by a cyclin dependent kinase: wherein A is a group R2 or CH2—R2 where R2 is a carbocyclic or heterocyclic group having from 3 to 12 ring members; B is a bond or an acyclic linker group having a linking chain length of up to 3 atoms selected from C, N, S and O; R1 is hydrogen or a group selected from SO2Rb, SO2NR7R8, CONR7R8, NR7R9 and carbocyclic and heterocyclic groups having from 3 to 7 ring members; R3, R4, R5 and R6 are the same or different and are each selected from hydrogen, halogen, hydroxy, trifluoromethyl, cyano, nitro, carboxy, amino, carbocyclic and heterocyclic groups having from 3 to 12 ring members; a group Ra—Rb wherein Ra is a bond, O, CO, X1C(X2), C(X2)X1, X1C(X2)X1, S, SO, SO2, NRc, SO2NRc or NRcSO2; and Rb is selected from hydrogen, carbocyclic and heterocyclic groups having from 3 to 12 ring members, and a C1-8 hydrocarbyl group optionally substituted by one or more substituents selected from hydroxy, oxo, halogen, cyano, nitro, amino, mono- or di-C1-4 hydrocarbylamino, carbocyclic and heterocyclic groups having from 3 to 12 ring members and wherein one or more carbon atoms of the C1-8 hydrocarbyl group may optionally be replaced by O, S, SO, SO2, NRc, X1C(X2), C(X2)X1 or X1C(X2)X1; Rc is hydrogen or C1-4 hydrocarbyl; X1 is O, S or NRc and X2 is ═O, ═S or ═NRc; R7 is selected from hydrogen and a C1-8 hydrocarbyl group optionally substituted by one or more substituents selected from hydroxy, oxo, halogen, cyano, nitro, amino, mono- or di-C1-4 hydrocarbylamino, carbocyclic and heterocyclic groups having from 3 to 12 ring members and wherein one or more carbon atoms of the C1-8 hydrocarbyl group may optionally be replaced by O, S, SO, SO2, NRc, X1C(X2), C(X2)X1 or X1C(X2)X1; R8 is selected from R7 and carbocyclic and heterocyclic groups having from 3 to 12 ring members; R9 is selected from R8, COR8 and SO2R8; or NR7R8 or NR7R9 may each form a heterocyclic group having from 5 to 12 ring members; but excluding the compounds N-[(morpholin-4-yl)phenyl-1H-indazole-3-carboxamide and N-[4-(acetylaminosulphonyl)phenyl-1H-indazole-3-carboxamide.
Owner:ASTEX THERAPEUTICS LTD

Salts and crystalline forms of an apoptosis-inducing agent

Salts and crystalline forms of 4-(4-{[2-(4-chlorophenyl)-4,4-dimethylcyclohex-1-en-1-yl]methyl}piperazin-1-yl)-N-({3-nitro-4-[(tetrahydro-2H-pyran-4-ylmethyl)amino]phenyl}-sulfonyl)-2-(1H-pyrrolo[2,3-b]pyridin-5-yloxy)benzamide are suitable active pharmaceutical ingredients for pharmaceutical compositions useful in treatment of a disease characterized by overexpression of one or more anti-apoptotic Bcl-2 family proteins, for example cancer.
Owner:ABBVIE INC

4,6-di- and 2,4,6-trisubstituted quinazoline derivatives useful for treating viral infections

This invention provides quinazoline derivatives represented by the structural formula: (I); wherein: R2 is hydrogen, NR′R″, C1-7 alkyl, arylC1-7 alkyl or C3-10 cycloalkyl; R4 is amino, C1-7 alkyl, C2-7 alkenyl, C3-10 cycloalkyl, C3-10 cycloalkenyl, aryl, heterocyclic, arylalkyl, heterocyclic-substituted C1-7 alkyl or C3-10 cycloalkyl-C1-7 alkyl; R5 is hydrogen or C1-7 alkyl, or R5 and R4 together with the nitrogen atom to which they are attached form a heterocyclic ring; Y is a single bond, C1-7alkylene, C2-7 alkenylene or C2-7 alkynylene; R6 is halogen, heteroaryl or aryl; R′ and R″ are each independently hydrogen, C1-7 alkyl-carbonyl or C1-7 alkyl; provided that R4 is not phenyl substituted with morpholino when R2 is H and R5 is H, and provided that when NR4R5 is piperazinyl, said NR4R5 is either non-substituted or substituted with methyl or acetyl; a pharmaceutically acceptable addition salt, a stereoisomer, a mono- or a di-N-oxide, a solvate or a pro-drug thereof, for the treatment of viral infections.
Owner:GILEAD SCI INC

Fused heterocyclic compounds

The present invention provides a compound of the formula: wherein ring A is an optionally substituted 5 to 10-membered aromatic ring; R1 and R2 are the same or different and each is an optionally substituted hydrocarbon group or an optionally substituted heterocyclic group; X is a bond and the like; and L is a divalent hydrocarbon group, and a salt thereof, except 3-(aminomethyl)-2,6,7-trimethyl-4-phenyl-1(2H)-isoquinolinone, 3-(aminomethyl)-2-methyl-4-phenyl-1(2H)-isoquinolinone, 3-(aminomethyl)-6-chloro-2-methyl-4-phenyl-1(2H)-isoquinolinone and 3-(aminomethyl)-2-isopropyl-4-phenyl-1(2H)-isoquinolinone. The compound shows a superior peptidase-inhibitory activity and is useful as an agent for the prophylaxis or treatment of diabetes and the like.
Owner:TAKEDA PHARMA CO LTD

Treating or preventing the early stages of degeneration of articular cartilage or subchondral bone in mammals using carprofen and derivatives

Treating or preventing the early stages of degeneration of articular cartilage or subchondral bone in the affected joint of a mammal is accomplished by administering a chondroprotective compound of Formula (I):where A is hydroxy, (C1-C4)alkoxy, amino, hydroxy-amino, mono-(C1-C2)alkylamino, di-(C1-C2)alkylamino; X and Y are independently H or (C1-C2)alkyl; and n is 1 or 2; R6 is halogen, (C1-C3)alkyl, trifluoromethyl, or nitro; R9 is H; (C1-C2)alkyl; phenyl or phenyl-(C1-C2)alkyl, where phenyl is optionally mono-substituted by fluoro or chloro; -C(=O)-R, where R is (C1-C2)alkyl or phenyl, optionally mono-substituted by fluoro or chloro; or -C(=O)-O-R', where R1 is (C1-C2)alkyl.This treatment ameliorates, diminishes, actively treats, reverses or prevents any injury, damage or loss of articular cartilage or subchondral bone subsequent to said early stage of said degeneration. Whether or not a mammal needs such treatment is determined by whether or not it exhibits a statistically significant deviation from normal standard values in synovial fluid or membrane from the affected joint, with respect to at least five of the following substances: increased interleukin-1 beta (IL-1beta); increased tumor necrosis factor alpha (TNFalpha); increased ratio of IL-1beta to IL-1 receptor antagonist protein (IRAP); increased expression of p55 TNF receptors (p55 TNF-R); increased interleukin-6 (IL-6); increased leukemia inhibitory factor (LIF); decreased insulin-like growth factor-1 (IGF-1); decreased transforming growth factor beta (TGFbeta); decreased platelet-derived growth factor (PDGF); decreased basic fibroblast growth factor (b-FGF); increased keratan sulfate; increased stromelysin; increased ratio of stromelysin to tissue inhibitor of metalloproteases (TIMP); increased osteocalcin; increased alkaline phosphatase; increased cAMP responsive to hormone challenge; increased urokinase plasminogen activator (uPA); increased cartilage oligomeric matrix protein; and increased collagenase.
Owner:PFIZER INC +1

Regulation of heterologous recombinant protein expression in methylotrophic and methanotrophic bacteria

Methylotrophic or methanotrophic bacteria such as Methylobacterium are transformed with a gene of interest, and expression of the gene is regulated by means of a cumate repressor protein and an operator sequence which is operatively linked to the gene of interest, and the addition of an external agent. Specifically, the cymR repressor and cmt operator from Pseudomonas putida may serve to regulate gene expression in methylotrophic or methanotrophic bacteria with the addition of cumate.
Owner:NAT RES COUNCIL OF CANADA

Thyroid receptor ligands and method II

New thyroid receptor ligands are provided which have general formula (I) in which: n is an integer from 0 to 4; R1 is halogen, trifluoromethyl, or alkyl of 1 to 6 carbons or cycloalkyl of 3 to 7 carbons; R2 and R3 are the same or different and are hydrogen, halogen, alkyl of 1 to 4 carbons or cycloalkyl of 3 to 5 carbons, at least one of R2 and R3 being other than hydrogen; R4 is a carboxylic acid amide (CONR′R″) or an acylsulphonamide (CONHSO2R′) derivative, or a pharmaceutically acceptable salt thereof, and all stereoisomers thereof; or when n is equal to or greater than one, R4 may be a heteroaromatic moiety which may be substituted or unsubstituted, or an amine (NR′R″). R5 is hydrogen or an acyl (such as acetyl or benzoyl) or other group capable of bioconversion to generate the free phenol structure (wherein R5=H). In addition, a method is provided for preventing, inhibiting or treating a disease associated with metabolism dysfunction or which is dependent upon the expression of a T3 regulated gene, wherein a compound as described above is administered in a therapeutically effective amount. Examples of such diseases associated with metabolism dysfunction or are dependent upon the expression of a T3 regulated gene include obesity, hypercholesterolemia, atherosclerosis, cardiac arrhythmias, depression, osteoporosis, hypothyroidism, goiter, thyroid cancer as well as glaucoma, congestive heart failure and skin disorders.
Owner:KARO BIO AB

Encapsulation system

InactiveUS20090269313A1Function increaseReduces host 's immune responseBiocideMetabolism disorderDelivery vehicleIslet cells
An encapsulation system for use in the treatment of diabetes (Types 1 or 2, and LADA) are provided. The system has (1) a delivery vehicle comprising a selectively permeable membrane that allows passage of glucose, insulin and other nutrients through the membrane, but prevents large molecules such as antibodies or inflammatory cells from passing through the membrane; (2) a population of islet cells or insulin producing cells encapsulated by said membrane; and (3) a biological response modifier that may be in contact with the membrane or encapsulated by the membrane. Generally, the biological response modifier is a compound, including resolved enantiomers, diastereomers, tautomers, salts and solvates thereof, having the following formula:wherein:X, Y and Z are independently selected from a member of the group consisting of C(R3), N, N(R3) and S;R1 is selected from a member of the group consisting of hydrogen, methyl, C(5-9)alkyl, C(5-9)alkenyl, C(5-9)alkynyl, C(5-9)hydroxyalkyl, C(3-8)alkoxyl, C(5-9)alkoxyalkyl, the R1 being optionally substituted;R2 and R3 are independently selected from a member of the group consisting of hydrogen, halo, oxo, C(1-20)alkyl, C(1-20)hydroxyalkyl, C(1-20)thioalkyl, C(1-20)alkylamino, C(1-20)alkylaminoalkyl, C(1-20)aminoalkyl, C(1-20)aminoalkoxyalkenyl, C(1-20)aminoalkoxyalkynyl, C(1-20)diaminoalkyl, C(1-20)triaminoalkyl, C(1-20)tetraaminoalkyl, C(5-15)aminotrialkoxyamino, C(1-20)alkylamido, C(1-20)alkylamidoalkyl, C(1-20)amidoalkyl, C(1-20)acetamidoalkyl, C(1-20)alkenyl, C(1-20)alkynyl, C(3-8)alkoxyl, C(1-11)alkoxyalkyl, and C(1-20)dialkoxyalkyl.
Owner:DIAKINE THERAPEUTICS

Method for treating non-small cell lung cancer

InactiveUS20130310440A1Organic active ingredientsRespiratory disorder5-MethylcytosineBorderline resectable
The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.
Owner:TEVA PHARMA IND LTD

Compositions Comprising Enzyme-Cleavable Oxycodone Prodrug

The embodiments provide Compound KC-7, N-1-[(S)-2-(oxycodone-6-enol-carbonyl-methyl-amino)-2-carbonyl-sarcosine-ethyl amine]-arginine-glycine-acetate, or acceptable salts, solvates, and hydrates thereof. The present disclosure also provides compositions, and their methods of use, where the \compositions comprise a prodrug, Compound KC-7, that provides controlled release of oxycodone. Such compositions can optionally provide a trypsin inhibitor that interacts with the enzyme that mediates the controlled release of oxycodone from the prodrug so as to attenuate enzymatic cleavage of the prodrug.
Owner:SIGNATURE THERAPEUTICS

Aryl- or heteroaryl-sulfonyl compounds as acid secretion inhibitors

The present invention provides a compound having a superior acid secretion inhibitory action, an antiulcer activity and the like.A proton pump inhibitor containing a compound represented by the formula (I)wherein ring A is a saturated or unsaturated 5- or 6-membered ring group optionally having, as a ring-constituting atom besides carbon atom, 1 to 4 hetero atoms selected from a nitrogen atom, an oxygen atom and a sulfur atom, ring-constituting atoms X1 and X2 are each a carbon atom or a nitrogen atom, a ring-constituting atom X3 is a carbon atom, a nitrogen atom, an oxygen atom or a sulfur atom, R1 is an optionally substituted aryl group or an optionally substituted heteroaryl group, R2 is an optionally substituted alkyl group, an optionally substituted aryl group or an optionally substituted heteroaryl group, R3 is an aminomethyl group optionally substituted by 1 or 2 lower alkyl groups, which is a substituent on a ring-constituting atom other than X1, X2 and X3, and ring A optionally further has substituent(s) selected from a lower alkyl group, a halogen atom, a cyano group and an oxo group, or a salt thereof or a prodrug thereof.
Owner:TAKEDA PHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products