Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

39 results about "Infectious gastroenteritis" patented technology

Recombination Lactococcus lactics for expressing pig infectious gastroenteritis virus S protein and preparation method thereof

The invention provides a recombination lactic acid galactococcus method of expessing pig transmissible gastroenteristis virus mutation S protein, which comprises the following steps: designing double primers according to the total gene order of pig Transmissible gastroenteristis virus S protein and gene fusion characteristic of expressing the carrier plasmid; proceeding PCR; getting the 2007bp destination fragments of four main antigen sites with TGEV S gene; connecting with the carrier plasmid PNZ8112 of secretory expression; getting into the host lactic acid galactococcus NZ9000 cell by electric conversion; expressing under the inducing of nisin. The invention constructs the expression carrier system of coronaviridae TGEV S mutein lactic acid galactococcus, which expresses about 66KDa destination protein of four main antigen sites with TGEV. Immunological ink mist experiment and indirect immunological fluorescein test indicate that the exogenesis protein is able to react with TGEV immunological serum and the recombination S protein has the same antigenic as TGEV natural antigenic.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Traditional Chinese medicine composition for treating porcine transmissible gastroenteritis

The invention provides a traditional Chinese medicine composition for treating porcine transmissible gastroenteritis. The traditional Chinese medicine composition comprises the following active pharmaceutical ingredients: costustoot, natural indigo, common goldenrod, perfoliote knotweed herb, cochinchnese asparagus root, fresh bamboo sap, pterocephalus hookeri, coix seed, common St. Paulswort herb, entada phaseoloides, tree-of-heaven ailanthus bark, small centipeda herb, Japanese flowering fern rhizome, kudzuvine root, ovateleaf holly bark, south dodder seed, rhizome, abelmoschus manihot, amur corktree bark, Chinese taxillus twig, bistort rhizome, pilose Asiabell root and ash bark. The traditional Chinese medicine composition can overcome the shortcomings of the existing western medicine therapy and has the advantages of good efficacy against the porcine transmissible gastroenteritis, low toxicity and side effects, less residue, rich resources and low price.
Owner:QINGDAO AGRI UNIV

Piglet drug-resistant colibacillosis treating traditional Chinese medicine composition

The present invention discloses a piglet drug-resistant colibacillosis treating traditional Chinese medicine composition, which comprises 5-40% of cortex phellodendri, 5-40% of scutellaria baicalensis georgi, 5-40% of hypericum perforatum l, 5-40% of valeriana jatamansi jones, 5-40% milkvetch root, and 5-40% of acorus tatarinowii. According to the present invention, the product can treat piglet infectious diseases caused by drug-resistant Escherichia coli, infectious gastroenteritis viruses or epidemic diarrhea viruses, and does not have adverse reactions, drug residues and drug resistance during the use process; the product adopts berberine, phillyrin and hyperoside as the quantitative indexes and adopts the control substances of berberine, phillyrin, hypericum perforatum l, valeriana jatamansi jones, milkvetch root and acorus tatarinowii as the identification indexes so as to control the quality; and the safety test results and the clinical trial results prove that the granular dosage form of the product is safe and effective.
Owner:SHENYANG VICA ANIMAL HUSBANDRY TECH +1

Recombinant lactococcus lactis expressing S600 gene of transmissible gastroenteritis virus of pigs and application

The invention discloses a recombinant lactococcus lactis expressing the S600 gene of a transmissible gastroenteritis virus of pigs and application. A constitutive expression vector pMG36e of lactococcus lactis MG1363 is utilized for expression. Lactococcus lactis is a generally regarded as safe (GARS) microorganism, and has a beneficial regulating effect on the growth of an animal. When a constitutive expression system of lactic acid bacteria expresses target protein, no inducer is required. In the process of self growth division, foreign target protein is synthesized, and toxicity and side effects in products caused by the inducer can be eliminated. A new mucosal immunity vaccine of infectious gastroenteritis of pigs is mixed with feed to obtain a mixture, and then the mixture is fed to pregnant sows and piglets for a period of time to prevent and control diseases such as viral diarrhea of pigs caused by the transmissible gastroenteritis virus of pigs.
Owner:HUAZHONG AGRI UNIV

Primers and probes for detecting porcine infectious gastroenteritis virus, fluorescent quantitative PCR kit, method and application

The invention discloses a primer and a probe for detecting porcine infectious gastroenteritis virus, a fluorescent quantitative PCR kit, a method and application, wherein, nucleotide sequence of primis as follows: upstream prim: 5' TTGTCTGGGTTGCCAAGGAT 3', downstream primer: 5' TCATTATTAGCACCACGACTACCAA 3'; the sequence of the probe is as follows: 5' FAM-CCATGAACAAACCAAC-MGB 3'. The invention hasthe advantages that: the reagent kit of the invention can quickly and accurately realize the detection of the porcine infectious gastroenteritis virus; the method is specific, sensitive and reproducible. The method and application provides a rapid and accurate method for the laboratory diagnosis and epidemiological investigation of porcine infectious gastroenteritis virus.
Owner:SHANDONG NEW HOPE LIUHE GROUP

Fodder used for preventing and controlling swine transmissible gastroenteritis and preparing method of fodder

The invention provides a fodder used for preventing and controlling swine transmissible gastroenteritis. The fodder is prepared from extruded corn, wheat middling, bone meal, whey powder, swelling soya dreg, imported fish meal, edible salt, premix and fodder additives, by improving matching of the raw materials, the content of nutrient elements like protein is increased, the nutrients are richer, the immunity of swine is improved, and the fodder is better preferred and secured by consumers. The fodder used for preventing and controlling swine transmissible gastroenteritis contains the fodder additives, can kill insects and germs, and therefore effectively prevent and control swine transmissible gastroenteritis. By using the fodder for preventing and controlling swine transmissible gastroenteritis, the quality of swine can be improved, the growth of the swine is effectively promoted, the morbidity of piglet transmissible gastroenteritis is drastically lowered, and therefore the interests of farmers are guaranteed.
Owner:安徽华米生物科技有限公司

Pork pig breeding method capable of preventing infectious gastroenteritis

The invention relates to a pork pig breeding method capable of preventing infectious gastroenteritis. The method comprises the steps that breeding pigs are obtained through artificial insemination and hybridization by taking pure-breed wild pigs as male parents and taking black sows as female parents; pork pigs are obtained through artificial insemination and hybridization by taking the breeding pigs as male parents and taking common sows as female parents; the pork pigs are fed on fermentation feed, wherein the fermentation feed is prepared from, by weight, 22-32 parts of corn stalks, 25-35 parts of cassava dregs, 14-24 parts of wheat, 2-4 parts of dried shredded ginger, 3-5 parts of shaddock peel and 1-2 parts of radix codonopsis. Compared with the prior art, the pork pig breeding method has the advantages that the adaptive capacity can be improved, the disease resistance can be enhanced, the growth speed is high, and the infectious gastroenteritis can be prevented.
Owner:柳州市宏华种猪有限公司

Shuanghuanglian for injection as a compound preparation of Chinese veterinary medicine and its preparation process and application

The invention relates to Shuanghuanglian for injection as a compound preparation of traditional Chinese veterinary medicine and its preparation process and application. The compound preparation of the present invention is prepared from the following medicines in parts by weight: 1250-3750 parts of honeysuckle, 1250-3750 parts of scutellaria baicalensis and 2500-7500 parts of forsythia. Sustained-release excipients are 200 parts of hydroxypropylmethylcellulose and 100 parts of sodium carboxymethylcellulose. Because it contains slow-release excipients, it can reduce the number of injections for large animals and reduce the stress response of large animals. The veterinary traditional Chinese medicine injection preparation of the invention has the effects of antiviral, antibacterial, anti-inflammatory, antipyretic and analgesic, and improving immunity. Its veterinary medicine can be used for coughs caused by epidemic diarrhea, infectious gastroenteritis, piglet paratyphoid, sepsis caused by various epidemic diseases, streptococcal disease, haemophilus parasuis, infectious pleuropneumonia, swine lung disease, etc. , dyspnea, cyanosis of the skin, joint swelling, lameness, porcine reproductive and respiratory syndrome, mastitis of cows.
Owner:JIANGXI ZHONGCHENG MEDICINE GROUP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products