95results about How to "Efficient way" patented technology

The invention discloses a method of producing bio-diesel by fermenting the heterotrophic chlorella in high density which belongs to the renewable biological energy field. The method uses the heterotrophic chlorella fermented in high density in the bio-reactor as a raw material, which screens the chlorella species having high growth rate and high oil content, directly inoculates into the bottle as the first-class germ to culture then transfers to the fermentation cylinder to undergo the second-glass high density fermentation; the reaction condition is then optimized, and the process is controlled; the culture containing the carbohydrate is dripped to provide the nutrition for the cell growth, therefore the heterotrophic chlorella cells cultured in high density with density of 108g / L and oil content of 61 percent are separated, collected and dried; the algae oil is extracted, and the bio-diesel is produced by transesterification reaction; the invention reduces the cost for the raw material of bio-diesel, and satisfies the demand of industrialized application of producing bio-diesel by heterotrophic chlorella cells, therefore the technique of the invention becomes an economical and effective way of making oils from bio-diesel materials.

The invention provides a method for a building multi-core operating environment, which is characterized in that: a plurality of pieces of cpu are divided into two groups in advance, wherein one group is on-line cpu which operates a standard Linux operating system for checking message content, and the other group is an off-line cpu for operating a specified target code; when all cpu relevant resource finishes initializing, parts of on-line cpu become the off-line cpu; the off-line cpu operates one endless loop function cpu_idle so as to embed the code inlet function of a specified target into the endless loop function cpu_idle; the off-line cpu operates the specified target code to classify and distribute received network message to the corresponding on-line cpu according to data flow. Theinvention can solve the problem that cpu cost sharp increases along with the increase of cpu amount under the Linux environment and provides a new efficient path for multi-core framework development.

The invention discloses a multi-scale simulation method for mechanical behaviors of a multi-phase composite material, and belongs to the field of multidisciplinary intersection of computational material science, analog simulation, high-throughput calculation and the like. Various physical property parameters needed by finite element simulation of the macroscopic scale can be obtained through calculation of the first principle of the nanoscopic scale, molecular dynamics simulation of the microcosmic scale and thermodynamic calculation of the mesoscopic scale, and the physical property parameters comprise elastic-plastic physical parameters of all phases in the composite material at different temperatures and different grain sizes and the like. A real material tissue structure is obtained byutilizing a focused ion beam experiment and image processing introduction. Through parameter coupling and parameter transmission among scale calculation results and combination with the structure ofthe material, mechanical behaviors such as stress-strain relationship, stress distribution and evolution and plastic deformation of the multi-phase composite material under complex stress and different temperatures can be simulated.

The invention discloses a single vanadium extraction and steelmaking method by a converter. The method comprises the following steps: carrying out KR stirring and desulfurizing on vanadium-containing molten iron to ensure that the sulfur content is reduced to 0.001-0.060%; then, fishing out over 97% of desulfurized slag in the vanadium-containing molten iron; blending the fished vanadium-containing molten iron into the converter filled with liquid vanadium-containing slag; adding vanadium-containing solid wastes for pure oxygen blowing to extract vanadium and make steel; in the blowing process, adding a proper amounts of lime, calcined dolomite and a compound slag former to form slag; then, adjusting the tilting angle of the converter; and pouring out the vanadium-containing slag from a fire door, wherein the vanadium-containing slag is used for extracting vanadium while semisteel left in the converter is continuously blown to prepare initially blown molten steel. The method disclosed by the invention realizes enrichment and cyclic utilization of vanadium resources by fully utilizing the beneficial element vanadium in the liquid vanadium-containing slag and the vanadium-containing solid wastes, thereby forming an efficient path for recycling slag and solid wastes generated by steelmaking of vanadium-containing molten iron. No special coolers are additionally added, so that the resources of the solid wastes are fully utilized and the economic benefit is good.

The invention relates to a preparation and an application of universal targeted CD19 antigen chimeric receptor T cells. Concretely, the invention relates to a method for preparing targeted CD19 antigen chimeric receptor T cells. The method comprises delivering a gene editing substance to the T cell to shear TRAC and B2M genes; and cloning the targeted CD19 CAR and B2M-HLA-E fusion gene into a repair template vector to simultaneously introduce targeted CD19 CAR and B2M-HLA-E fusion gene homologous recombination repair templates into T cells. The universal targeted CD19 antigen chimeric receptorT cell has the advantages of small allograft rejection reaction, high yield, high safety, immediate availability, wide application range and the like.

The invention relates to a pair of augmented reality subtitle glasses for simultaneous translation, which is provided with the equipment such as a voice receiving module, a voice / text conversion module, an embedded microcontroller, a memory, an identity recognition module, a text input module, a text / voice conversion module, a voice output module and a display screen, and is characterized in thatthe mutual conversion between voice and texts is realized through the voice / text conversion module and the text / voice conversion module in the AR glasses, the simultaneous translation between different languages is realized through a translation module, text information is presented on the display screen of the AR glasses as subtitles, and a user A and a glasses wearer can know what the opposite side expresses through browsing the subtitles on the display screen or directly listen to the voice broadcast. the problem of inconvenient communication between different types of people is effectivelysolved through the augmented reality subtitle glasses for simultaneous translation, thereby not only providing a good way for the deaf to return to the normal life and reintegrate into the society, but also being capable of realizing the simultaneous translation between Chinese and foreign languages.

The invention discloses a CFD-based heavy metal wastewater sulfuration precipitation reactor optimization method. The method comprises the following steps: establishing a fluid computational domain geometric model of a sulfuration precipitation reactor; according to the established geometric model, determining a control equation and defining a boundary condition and an initial value of the model according to an actual situation and a design thought; meshing the geometric model of the sulfuration precipitation reactor, and solving flow field and reaction substance concentration distribution and the like of the model by using multi-physical field coupling; by modifying related parameters, repeating the process, performing multiple numerical simulation calculations, and comparing and analyzing calculation results under different geometric structures and technological parameters to obtain the optimal reactor structure and technological parameters. According to the invention, simulation calculation can be carried out on the sulfuration precipitation process under different reactor structures and process parameters to obtain results such as inlet and outlet water concentrations of the reactor, flow field distribution characteristics in the reactor, concentration distribution of each substance and the like so as to evaluate the reactor performance under different conditions.

The invention provides a ball-rolling type ocean wave generator. The ball-rolling type ocean wave generator comprises a floating boat, hinges are arranged at the two ends of the floating boat, and a balance plate, a steel ball, a steel ball rolling groove, gear racks, gear rack guide rails, a driving gear, one-way ratchet wheels, variable gears, flywheels, generator bodies, a limiting pillar, balance plate supports, shaft supports and a bottom plate are arranged in the floating boat. The floating boat is a sealed structure body, and the two generator bodies are arranged inside the floating boat. The floating boat can be fixed to the seabed or a ship or other floating objects through one rope. Along with waving of ocean waves, the steel ball rolls along the steel ball rolling groove, and the balance plate rotates accordingly to drive the gear racks to move vertically so that the driving gear can rotate to drive the generator bodies to generate power. The ball-rolling type ocean wave generator has the advantages of being simple in structure, reliable in performance, high in efficiency, free of pollution, easy to arrange and popularize, small in investment, rapid in reward and the like.

The invention discloses an SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and an application thereof, relating to a plant breeding assistive technology. The nucleotide sequence of a primer of the SSR marker which is closely linked with the cucumber leaf color mutant genes v-1 is as follows: SSR8v-1-F / SSR8v-1-R: GGCAATGGTAAAGGTTGGAA / AAGGGATGTGTGGTGTGGTT; a characteristic strip of the SSR marker linked with the leaf color mutant genes v-1, which is amplified by the primer, is 194bp, and the nucleotide sequence is as shown in Seq ID No. 1; the characteristic strip of the SSR marker linked with leaf green genes V-1, which is amplified by the primer, is 206bp, and the nucleotide sequence is as shown in Seq ID No. 2. By adopting the SSR marker obtained according to the invention, the leaf color mutant genes v-1 can be screened in any stage against plant materials; the SSR marker has the advantages of high efficiency, few limitations and accuracy, and can improve the selection efficiency and accuracy of breeding plant high-light efficiency yellow leaf materials and also provide a simple, convenient and efficient way for assisted breeding of high-light efficiency breeding materials by utilizing the SSR marker which is co-segregated from leaf color control genes.

The invention discloses a multi-session binding method, device and system. The method comprises that a user terminal receives PCRF related information which is distributed by a PGW when the user terminal establishes a first IP-CAN session of a Gx interface; and the user terminal sends an invitation message, which carries the PCRF related information, to an AF, and the AF is thus indicated to set PCRF as a target host for authenticating application messages when the user terminal establishes the session of the Rx interface.