Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and application thereof

A technology for mutating genes and cucumber leaves, which is applied in the field of biotechnology-assisted breeding, can solve the problems of far actual physical location, unverified accuracy, and inability to locate leaf color genes on chromosomes, etc., achieving less restrictions and improving selection efficiency and accuracy Effect

Active Publication Date: 2014-07-23
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the above research work has not yet achieved the cloning of genes controlling cucumber leaf color.
Because the obtained AFLP markers are random markers, the leaf color gene cannot be located on the chromosome; while the co-dominant SSR and CAPS markers are closely linked to the leaf color gene and have a close genetic distance, but the actual physical location on the chromosome The position is still far away, and the accuracy of these markers for molecular marker-assisted selection of materials with different genetic backgrounds has not been verified, so the actual application in molecular marker-assisted breeding of cucumbers is limited, and a genetic distance closer to the leaf color gene needs to be developed, and Molecular markers that do have substantial application value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and application thereof
  • SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and application thereof
  • SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1. Acquisition of co-segregated SSR markers with cucumber leaf color mutant gene v-1

[0028] Step 1. Cucumber leaf color mutation gene v-1 co-segregation marker acquisition

[0029] (1) DNA extraction:

[0030] Take the young leaves of cucumber plants, and use the improved CTAB (cetyltrimethylammonium bromide) method to extract the genomic DNA of each individual plant of the parent and RIL populations.

[0031] (2) SSR marker analysis:

[0032] 1) PCR reaction system: 10 μL total reaction system, 3 μL DNA (2.5ng μL-1), 1 μL forward and reverse primers (50ng μL-1), 5 μL Go Green Master Mix (promega company product). Based on the mapping of the leaf color gene v-1, the molecular markers of cucumber linkages in the International Cucurbitaceae Genome Database (www.icugi.org) were used.

[0033] 2) PCR amplification program: PCR amplification program: 94°C pre-denaturation for 4 minutes; 94°C denaturation for 15 seconds; 55°C annealing for 15 seconds; 72°C extens...

Embodiment 2

[0059] Verification of embodiment 2.v-1 gene co-segregation marker

[0060] The SSR marker SSR8 obtained in Example 1 and co-segregated with the v-1 gene v-1 In 440 copies of F built with 9110Gt×9930 2 Group and 43 different genetic background materials (Table 1) were verified to determine the accuracy of the marker for molecular marker-assisted selection. The verification adopts the PCR amplification and detection method in step (1) in Example 1.

[0061] Table 143 different genetic background materials

[0062] Numbering breed name source and access Numbering breed name source and access 1 Zhongnong No. 6 Institute of Vegetables, Chinese Academy of Agricultural Sciences 23 Jiza No. 16 Jilin Vegetable and Flower Research Institute 2 Zhongnong No. 8 Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences 24 Jifeng Jilin Vegetable and Flower Research Institute 3 Zhongnong No. 9 Institute of Vegetables...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and an application thereof, relating to a plant breeding assistive technology. The nucleotide sequence of a primer of the SSR marker which is closely linked with the cucumber leaf color mutant genes v-1 is as follows: SSR8v-1-F / SSR8v-1-R: GGCAATGGTAAAGGTTGGAA / AAGGGATGTGTGGTGTGGTT; a characteristic strip of the SSR marker linked with the leaf color mutant genes v-1, which is amplified by the primer, is 194bp, and the nucleotide sequence is as shown in Seq ID No. 1; the characteristic strip of the SSR marker linked with leaf green genes V-1, which is amplified by the primer, is 206bp, and the nucleotide sequence is as shown in Seq ID No. 2. By adopting the SSR marker obtained according to the invention, the leaf color mutant genes v-1 can be screened in any stage against plant materials; the SSR marker has the advantages of high efficiency, few limitations and accuracy, and can improve the selection efficiency and accuracy of breeding plant high-light efficiency yellow leaf materials and also provide a simple, convenient and efficient way for assisted breeding of high-light efficiency breeding materials by utilizing the SSR marker which is co-segregated from leaf color control genes.

Description

technical field [0001] The invention relates to the field of biotechnology-assisted breeding, in particular to the SSR marker of cucumber leaf color mutation gene v-1 and its application in plant breeding material selection. Background technique [0002] Cucumber (Cucumis sativus L.) is an annual climbing herb. my country is the country with the widest cultivation area and the highest total output of cucumber in the world. Leaf color mutants are ideal materials for studying the structure and function of the photosynthetic system and its regulatory mechanism, and are also valuable basic materials for genetic and breeding research. At present, the research on the mutation traits of cucumber leaf color is limited to the occurrence, classification, and genetic law of cucumber leaf color mutants, and the mechanism of color change of mutants is still unclear. [0003] Leaf color is directly related to the photosynthetic efficiency of plants, and is closely related to crop yield, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 苗晗顾兴芳张圣平王烨
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More