Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

31results about How to "Avoid Biosecurity Risks" patented technology

Antibacterial hydrocolloid and preparation method of antibacterial hydrocolloid

The invention relates to antibacterial hydrocolloid and a preparation method of the antibacterial hydrocolloid and belongs to the technical field of medicine. Through the fiber superfine pulverization technology, hydroxypropyl trimethylammonium chloride chitosan fiber with high antibacterial performance is processed into superfine powder bodies with the average particle diameter being 1 to 5mum, the superfine powder bodies, hot sol substances, moisture absorption macromolecules and tackifiers are sequentially added in different process stages, and the hydrocolloid is formed, so the potential biosafety risk caused by the use of nanometer metal as antibacterial agents is avoided. The traditional preparation process of the hydrocolloid is changed through the preparation method of the antibacterial hydrocolloid provided by the invention. When the antibacterial hydrocolloid prepared by the invention acts on wound, bacteria on the surfaces of the chronic wound can be killed, the wound infection can be prevented, meanwhile, a large amount of wound transudate can be absorbed, micro gel is formed after the transudate absorption, the humid environment is provided for the wound, and the wound healing is promoted.
Owner:WUHAN TEXTILE UNIV

Biological sample transferring box and method

The invention provides a biological sample transferring box and method. The transferring box is provided with a multilayer protection structure and comprises a sample protection box, an inner heat preservation box and an outer heat preservation box. The sample protection box is used for containing a sample container containing a biological sample. The sample protection box is arranged in the low-temperature negative-pressure inner heat preservation box. The inner heat preservation box is arranged in the heat preservation box with a heat preservation function. The inner heat preservation box comprises an inner box with an inner heat preservation layer and an inner box cover matched with an opening in the upper end of the inner box. A gas channel assembly communicating with the interior of the inner box is arranged on the inner box cover. The biological sample transferring box is convenient to use, safe and reliable; by arranging two heat preservation layers, heat exchange between the outside and the interior of the box is reduced; and by placing an ice box in the inner heat preservation box, the interior of the inner box is vacuumized through the gas channel assembly arranged on theinner box cover, the biological sample is in a low-temperature negative-pressure condition, and it is avoided that biological factors possibly with biological safety risks are diffused to the outsideto pollute the environment.
Owner:JINYUBAOLING BIO PHARMA CO LTD

TALEN-mediated vector for knocking out goat BLG through gene targeting and recombinant cell

The invention discloses a TALEN-mediated vector for knocking out goat BLG through gene targeting and a recombinant cell. A TALEN eukaryotic expression vector aiming at a first exon of a goat beta-lactoglobulin gene and a BLG gene knockout vector containing short homologous arms are designed and constructed according to the goat beta-lactoglobulin gene and are jointly transfect goat fetal fibroblast together with mRNAs obtained by in vitro transcription based on TALEN expression vector as a template, and a BLG gene knockout cell is obtained after drug screening and identification. According to the invention, the gene targeting efficiency is greatly improved by utilizing a TALEN technology; meanwhile, the utilization of the short homologous arms facilitates more convenient and more efficient screening of the targeted cells; random integration of the TALEN expression vector in genomes is avoided by utilizing mRNAs.
Owner:NORTHWEST A & F UNIV +1

Fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application of the fusion protein

The invention discloses a fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application of the fusion protein. An N-terminal signal peptidesequence of the OMP25 protein and an N-terminal signal peptide sequence of the BP26 protein are deleted, and an antigenic determinant sequence of the OMP25 protein and the BP26 protein is reserved; the fusion protein is formed by connecting a Linker sequence GGAGGCGGGGGTTCTGGAGGCGGGGGTTCT in the middle; the N-terminal signal peptide sequence of the OMP25 protein is the first aa-29th aa, and the N-terminal signal peptide sequence of the BP26 protein is the first aa-24th aa. Compared with single protein, the protein is more economical, convenient and better in antigenicity. The protein is obtained with less time consumption and high yield, the culture and biological safety risks of viable bacteria are avoided, the specificity is strong, and the positioning of the Brucella cell epitope is more beneficial to reveal the essence of humoral immunity.
Owner:SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY

Rapid nucleic acid sequencing method based on fluorescence PCR

The invention relates to a rapid nucleic acid sequencing method based on fluorescence PCR, is successfully applied in sequencing of bacterial genes, and can be used for identification of pathogenic bacteria. An FTA card nucleic acid is used for saving pathogenic bacteria nucleic acid, a real-time fluorescence PCR technology is used for amplifying a target fragment, and machine loading is performed for double deoxidization sequencing. A developed fluorescence PCR rapid sequencing reagent kit includes the following reagents: 1) one piece of FTA card; 2) one tube of PCR reaction liquid internally filled with an SYBR GREEN fluorescent PCR reaction solution; 3) one tube of an upstream primer and one tube of a downstream primer which are internally filled with target sequence amplification and sequencing primers; 4) a set of double deoxidization sequencing reagents; 5) a set of sequencing product purification reagents including one tube of a XTerminator solution and one tube of an SAM solution; and 6) one tube of deionized water internally filled with DNA enzyme-free sterile deionized water. Because the FTA card is used for saving the nucleic acid, after the card is dried naturally, the card can be stored for a long time at room temperature, is easy to save, has no need for nucleic acid extraction during PCR amplification, and avoids biological security risks of a bacterial suspension treating operation process during common bacteria gene sequencing.
Owner:汕头国际旅行卫生保健中心

Method for promoting earlier blooming of chrysanthemums by utilizing grafting mediated RNAi (Ribonucleic Acid interfere) technology

The invention belongs to the technical field of plant cultivation, relates to a regulation and control method for a plant blooming stage and more specifically relates to a method for promoting earlier blooming of chrysanthemums by utilizing a grafting mediated RNAi (Ribonucleic Acid interfere) technology. The method comprises the following steps: carrying out rootstock preparation, carrying out scion selection, carrying out grafting operation and the like; and a rootstock is a transgenic chrysanthemum material with a methylation gene which is silenced by adopting the RNAi technology. According to the method provided by the invention, the transgenic chrysanthemum material is only used as the rootstock and is not used for blooming, so that bio-safety risks of genetic drift can be avoided relatively well; and furthermore, a grafting technology is applied so that the earlier blooming of different chrysanthemum varieties can be realized through the material of only one transgenic chrysanthemum variety, transgenic operation of each variety is avoided and the applicability is relatively good. According to the method for promoting the earlier blooming of the chrysanthemums, provided by the invention, the earlier blooming aim is realized relatively well on the basis of ensuring the normal growth of plants and stabilizing the quality of the chrysanthemums, so that the method has relatively good application values on cultivation of earlier blooming series of good varieties.
Owner:HENAN UNIVERSITY

Broad-spectrum neutralizing antibody for resisting novel coronavirus and application of broad-spectrum neutralizing antibody

ActiveCN114560930AAvoid Biosecurity RisksEfficient and broad-spectrum neutralizing activityImmunoglobulins against virusesAntiviralsAntigenMolecular biology
The invention relates to a broad-spectrum neutralizing antibody for resisting novel coronavirus and application of the broad-spectrum neutralizing antibody. The invention provides an anti-novel coronavirus broad-spectrum neutralizing antibody or an antigen binding fragment thereof, the broad-spectrum neutralizing antibody or the antigen binding fragment thereof has a heavy chain variable region containing VHCDR1, VHCDR2 and VHCDR3 and a light chain variable region containing VLCDR1, VLCDR2 and VLCDR3, the VHCDR1, the VHCDR2 and the VHCDR3 respectively comprise amino acid sequences shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the VLCDR1, the VLCDR2 and the VLCDR3 respectively comprise amino acid sequences shown as SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6. The finally screened antibody has efficient and broad-spectrum neutralizing activity, the IC50 of the antibody to a wild type of the novel coronavirus and 13 mutant strains is less than 0.05 g / ml, and the IC50 of the antibody to WT, Beta, Delta and Omicro BA.1 live viruses is less than 0.1 g / ml.
Owner:TSINGHUA UNIV +1

Preparation method of brucella capsid vaccine strain

A preparation method for Brucella shell vaccine strain is disclosed, relates to the field of molecular biology and microbiology, and helps to solve the problem that conventional bacteria shell preparation method is high in cost and not suitable for large-scale production. The method comprises: respectively cloning PCR products of homogenous arms at the upstream and at the downstream of a specific gene of Brucella strain genome to a pMD18-T Simple vector to construct recombinant plasmids, performing double digestion on the recombinant plasmids, successively connecting with plasmid pBK-CMV-SacB subjected to digestion processing for constructing a suicide plasmid, performing PCR amplification on a temperature-control lysis part of a temperature-control expression plasmid pBV220-E, performing digestion processing on the amplification product, inserting into the suicide plasmid; and transforming the temperature-control lysis type suicide plasmid into competent Brucella, and performing positive and negative screening by utilizing kanamycins resistance and fructose sucrase gene, so as to obtain the Brucella shell vaccine strain. The Brucella shell vaccine strain has good heredity stability, security, effectiveness and immunogenicity.
Owner:MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI

Livestock breeding waste treatment and fermentation system

The invention discloses a livestock breeding waste treatment and fermentation system which comprises a manure collection pool used for collecting waste generated in the livestock breeding process; a first treatment module which comprises a crusher and a first plunger pump, wherein the crusher is used for carrying out crushing treatment on waste, the crusher is connected with the sealed plunger pump, and the waste treated by the crusher enters the plunger pump; an auger conveyor, wherein the input end of the auger conveyor is communicated with the manure collection pool, and the output end of the auger conveyor is connected with a stock bin of the crusher in a sealed mode, so that the waste can be conveyed into the crusher from the interior of the manure collection pool; and a fermentation tank which is used for realizing fermentation treatment of the wastes. By means of the pipeline transportation mode, the whole transportation pipeline is sealed, so that the biological safety risk of open-air transportation is avoided; the whole system is controlled through a PLC, so that the automation degree is higher; and compared with a traditional transportation mode, labor use is greatly reduced.
Owner:青岛凯昇环保设备制造有限公司

Biological safety type full-automatic capping and sample information management device

A biological safety type full-automatic capping and sample information management device comprises a closed working box, an operation panel is fixed to the left side of the working box, a working cabin is arranged on one side of the operation panel, an aerosol harmless treatment cabin is arranged on one side of the working cabin, a negative pressure cover is fixed to the top of the working box, and an exhaust fan is fixed to the negative pressure cover. The exhaust fan is connected with the aerosol harmless treatment cabin through an air supply pipe; and the working box is provided with a data processing cabin and a power supply cabin, a PCB is fixed in the data processing cabin, a storage battery is fixed in the power supply cabin, the operation panel is fixed on the outer sides of the data processing cabin and the power supply cabin, the operation panel is connected with the PCB, and the PCB is connected with the storage battery. The device not only can cover the test tubes in batches, but also can scan information bar codes on the test tubes and sort and insert the test tubes according to the detection sample information on the test tubes according to the sampling time, so that the test tubes with overdue detection samples can be conveniently taken out; and the biological safety of the device is better.
Owner:FIRST AFFILIATED HOSPITAL OF KUNMING MEDICAL UNIV

Blood sample separation method and blood sample separation device

The invention provides a blood sample separation method and a blood sample separation device. The blood sample separation device comprises a sample separation needle, a puncture needle and a driving mechanism connected with the sample separation needle and the puncture needle, the puncture needle is provided with a hollow structure, and the sample separation needle is arranged in the hollow structure in a penetrating mode. The method comprises the steps that the driving mechanism drives the puncture needle to penetrate through a test tube cover of a target test tube and drives the sample separation needle to move downwards in the hollow structure of the puncture needle; serum in the target test tube is taken by the sample separation needle; the driving mechanism drives the sample separation needle to move upwards in the hollow structure of the puncture needle and drives the puncture needle to move upwards to leave the test tube cover of the target test tube. The puncture needle penetrates through the test tube cover of the test tube, and then the sample separation needle moves downwards in the hollow structure of the puncture needle to take serum in the test tube, so that a blood sample can be taken without taking off the test tube cover, the test tube cover covers the tube body of the test tube after the blood sample is taken, a cover or a film does not need to be added, biological safety risks can be effectively avoided, the workload is reduced, and the cost is saved.
Owner:SHENZHEN MINDRAY BIO MEDICAL ELECTRONICS CO LTD

Reagent lid and sample reagent loading device

The invention relates to the technical field of biochemical analysis, in particular to a reagent pot cover, which includes a condensation plate and a water receiving tray oppositely arranged, the condensation plate and the water receiving tray are detachably connected, and a The air flow channel; a first sampling hole is provided on the condensing plate, and a second sampling hole is provided on the water tray corresponding to the first sampling hole, and the outline of the first sampling hole can completely cover the outline of the second sampling hole. In the reagent pot cover, since an air flow channel is formed between the condensation plate and the water receiving tray, the cold air in the reagent pot will enter into the air flow channel. Outside air enters from the first sampling hole of the condensation plate and merges with the cold air in the airflow channel without reaching the water receiving tray. In this way, the condensation only occurs on the side of the condensation plate of the air flow channel, and the condensed water drops around the first sampling hole and falls on the water tray, but does not form condensed water around the second sampling hole and cause the condensed water to drop to the reagent box superior. The present invention also relates to a sample reagent loading device.
Owner:CHENGDU SHEN MINDRAY MEDICAL ELECTRONICS TECH RES INST +1
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products