Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

78 results about "Legionella pneumophilia" patented technology

Legionella pneumophila is a thin, aerobic, pleomorphic, flagellated, nonspore-forming, Gram-negative bacterium of the genus Legionella. L. pneumophila is the primary human pathogenic bacterium in this group and is the causative agent of Legionnaires' disease, also known as legionellosis.

Method for detecting pneumonia causative bacteria using nucleic acid chromatography

Provided are a method and a kit for accurately and rapidly detecting ten types of targeting pneumonia bacteria: Streptococcus pneumoniae, Haemophilus influenzae, Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, Klebsiella pneumoniae, Pseudomonas aeruginosa, Moraxella catarrhalis, methicillin-resistant Staphylococcus aureus (MRSA), and Staphylococcus aureus. A set of primer pairs directed to their respective target regions contained in the DnaJ gene, etc., of the ten types of pneumonia causative bacteria is designed for the ten bacterial strains and used to amplify gene products. A set of bacterial strain-specific probe pairs is further designed for the ten bacterial strains such that the probe pairs hybridize with the amplification products via sequences in the respective target regions differing from the sequences hybridized by the set of primer pairs. A first probe-bound labeled high molecular carrier in which plural types of first probes for the pneumonia bacteria are bound to a labeled high molecular carrier and a solid-phase second probe-carrying developing support are used as the set of probe pairs to perform nucleic acid chromatography.
Owner:YAMAGUCHI TECH LICENSING ORG

Detection and enumeration of microorganisms

A method for detecting and enumerating viable microorganisms in a sample suspected of containing said microorganisms (1) contacting said microorganisms of said sample with at least one repair compound and a growth medium, and (2) incubating the product of steps (1), and (3) detecting and quantifying said viable microorganisms, in which the microorganisms are of the species Legionella pneumophila, and in which the repair compound directly or indirectly causes an effect on the metabolism to reduce the oxidative stress of the microorganism. The invention also includes a kit for more accurately detecting and enumerating viable microorganisms of the species Legionella pneumophila in a sample suspected of containing said microorganisms.
Owner:BASF AG +1

Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila

ActiveCN102424862AMake up for the lack of detection rangeLow costNucleotide librariesMicrobiological testing/measurementNucleotideGenomic DNA
The present invention provides a genotyping chip for legionella pneumophila, and a kit for detection of the legionella pneumophila. The chip and the kit are mainly provided according to the 11 serotypes of the legionella pneumophila, wherein the 11 serotypes comprise O1, O2, O3, O4, O5, O6, O7, O11, O12, O13 and O15. The gene chip comprises a solid phase carrier and oligonucleotide probes fixed on the solid phase carrier, wherein the oligonucleotide probes comprise DNA fragments selected from wzm gene, wzt gene and wecA gene, or complementary DNA fragments of the wzm gene, the wzt gene and the wecA gene, wherein the wzm gene, the wzt gene and the wecA gene have significant biological evolution advantages. According to the present invention, the genomic DNA of the sample requiring detection is amplified by the designed primers; the resulting amplified genomic DNA is labeled; the resulting labeled genomic DNA is subjected to hybridization with the gene chip; according to the resulting hybridization signals, the different serotypes of the legionella pneumophila can be detected. With the gene chip of the present invention, the purpose of the detection of the serotypes of the legionella pneumophila can be achieved, the operation is convenient, the accuracy is high, the repeatability is strong, and the accurate medical medication guidance is provided.
Owner:NANKAI UNIV

Multiple quantitative PCR (polymerase chain reaction) kit for quick combined detection of four bacteria difficult to cultivate and identify

The invention provides a multiple quantitative PCR (polymerase chain reaction) kit for quick combined detection of four bacteria difficult to cultivate and identify. The multiple quantitative PCR kit comprises four PCR reaction systems, wherein the four PCR reaction systems comprise AllGlo fluorescence probes and forward and reverse primers aimed at the following four pathogens which cause child bacterial pneumonia and are clinically difficult to cultivate and identify: haemophilus influenza, streptococcus pneumonia, moraxella catarrhalis and legionella pneumophila. According to the multiple quantitative PCR kit, the design is reasonable, the infection of the four pathogens, clinically difficult to cultivate and identify, of child bacterial pneumonia can be easily, conveniently, quickly and parallelly detected in a reaction tube at the same time, the situation that four bacteria are detected at the same time through single-tube PCR is achieved, quantitative detection is achieved, the kit is easy and quick to operate, high in sensitivity, good in specificity and repeatability, accurate and reliable in result, early specific diagnosis, prevention and treatment can be provided for patients suffering from infantile pneumonia according to the bacterial infection titer, and the kit has great clinical practicability for interdicting an infection source, reducing infection or mixed infection of the four bacteria and monitoring the clinical curative effect.
Owner:HANGZHOU FIRST PEOPLES HOSPITAL

Detection kit and detection method for I-form legionella pneumophila

The invention discloses a detection kit and a detection method for I-form legionella pneumophila. The detection kit comprises a PCR (polymerase chain reaction) reaction liquid, wherein the PCR reaction liquid comprises first reaction liquid and second reaction liquid which are separated from each other, and the second reaction liquid contains enzyme; the first reaction liquid contains a primer probe for carrying out fluorescent quantitation PCR on target genes of I-form legionella pneumophila. The detection method comprises the steps of extracting DNA of a to-be-detected sample, carrying out real-time fluorescent PCR and comparing and judging a fluorescence signal detection result with a control group. According to the detection kit, the first reaction liquid containing the primer probe of the I-form legionella pneumophila and the second reaction liquid containing enzyme can be directly mixed to carry out real-time fluorescent PCR, so that the I-form legionella pneumophila can be rapidly detected; furthermore, the pollution is avoided, and the sensitivity is high.
Owner:深圳生科原生物有限公司

Detection method for distinguishing non-pneumophilia legionella and legionella pneumophilia and kit

The invention discloses a detection method for distinguishing non-pneumophilia legionella and legionella pneumophilia and a kit. The method detects legionella and legionella pneumophilia through single tube amplification of multi-wavelength fluorescent polymerase chain reaction (PCR) technology of a TaqMan probe by adopting a legionella target sequence SEQ ID No.1 design-based primer probe, and distinguishes the non-pneumophilia legionella and the legionella pneumophilia according to the result; and meanwhile, an artificially constructed internal reference system for avoiding false negative detection results is also adopted in the kit. The kit comprises nucleic acid extract, PCR buffer solution, a fluorescent probe, Taq enzyme, an internal reference, and negative and positive contrasts; and two steps comprising sample treatment and amplification detection are used in the kit. The kit is simple and convenient to operate, has high sensitivity, can avoid false positive generated by nucleic acid pollution of PCR products, can solve the problem of false negative caused by a PCR inhibitor in the sample, and can be widely applied to disease control and quick detection of the legionella and the legionella pneumophilia in clinic.
Owner:SHANGHAI XINGYAO MED TECH DEV CO LTD +1

Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof

The invention discloses a rapid diagnostic reagent kit of legionella pneumophilia genes based on a loop-mediated isothermal amplification technique and a detecting method thereof, wherein the reagentkit consists of two pairs of primers, DNA polymerase, a stable liquid, a reaction liquid, a sample pretreatment liquid, a color rendering liquid and a positive contrast liquid which are respectively placed in a container. The gene rapid diagnostic reagent kit can judge whether target substances exist or not by applying applies six sections and the four primers according amplification or non-amplification, and thereby has high specificity. The gene rapid diagnostic reagent kit has high speed, high efficiency and high sensitivity, only needs a constant temperature for amplification reaction without special reagents and equipment, and has low detection cost. The gene rapid diagnostic reagent kit has simple identification, can generate magnesium pyrophosphate deposits as a byproduct by combining pyrophosphate ions precipitated from dNTP and Mg<2+> in a reaction solution, can identify the magnesium pyrophosphate deposits through visual study, and has remarkable color rendering difference ofnegative and positive results after the color rendering liquid is added, and is more marked and reliable.
Owner:GUANGZHOU HUAFENG BIOTECH

Compositions And Methods For The Rapid Detection Of Legionella pneumophila

The present application describes compositions and methods useful for the rapid detection of Legionella pneumophila. The compositions include capture probes, amplification primers, primer sets and detection probes that comprise nucleic acid molecules that hybridize to L. pneumophila 23S rRNA or DNA encoding 23S rRNA target sequences. Also described are methods for detecting and / or quantifying the amount of L. pneumophila in a sample using real time PCR (rPCR) or revere transcriptase real time PCR (RT-rPCR).
Owner:GENERAL ELECTRIC CO

Method for Specific Detection of Legionella Pneumophila

A method for specific detection of the presence of Legionella pneumophila in a sample that is suspected to contain L. pneumophila and which further comprises one or more other microorganism(s).
Owner:UNIV DE GIRONA

Legionella pneumophilia test kit and application thereof

The invention relates to a legionella pneumophilia test kit, in particular to a fast test kit of legionella pneumophilia in a drinking water system and application thereof, belonging to the technical field of molecule test. The legionella pneumophilia test kit comprises the following primers: external primers including a Primer F2: 5'TGCAAGACGCTATGAGTGGCGC 3' and a Primer R2: 5'TCCCAAGTTGATCCAGCGGGCA 3'; and internal primers including a Primer F1: 5'TGAGTGGCGCTCAATTGGCT 3' and a Primer R1: 5'AACCTGGAACGTTGCTGGCT 3'. Aiming at the characteristic of low concentration of legionella pneumophilia in the drinking water system, the legionella pneumophilia test kit provided by the invention adopts high-specificity primers and a midway advance and retreat nest type PCR (Ploymerase Chain Reaction) amplification technology to realize high specificity and sensitivity of test.
Owner:SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products