Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group for multiple RPA detection of respiratory tract pathogens, detection reagent and kit

A technology for detecting reagents and respiratory tract, which is applied in the field of molecular biology and can solve the problems of amplification annealing temperature, cooling rate and difficulty, etc.

Active Publication Date: 2020-05-15
FUJIAN PROVINCIAL HOSPITAL +2
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since RPA technology is usually carried out under isothermal conditions, it cannot avoid the differences in Tm values ​​and amplification efficiencies between different respiratory pathogen primer sets during multiple detection by adjusting the annealing temperature and cooling rate during the reaction like ordinary PCR amplification. The mutual interference between various amplification products brought about also makes it very difficult to obtain highly specific RPA amplification primers suitable for multiple detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for multiple RPA detection of respiratory tract pathogens, detection reagent and kit
  • Primer group for multiple RPA detection of respiratory tract pathogens, detection reagent and kit
  • Primer group for multiple RPA detection of respiratory tract pathogens, detection reagent and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0074] The experimental methods used in the following examples and comparative examples are conventional methods unless otherwise specified.

[0075] The materials and reagents used in the following examples and comparative examples can be obtained from commercial sources unless otherwise specified.

Embodiment

[0077] (1) A primer group for multiple RPA detection of respiratory pathogens, the primer group consists of 15 pairs of primers, and the construction process of the primers is as follows:

[0078] 1) The inventors used Clustal Omega and Vector NTI Suite 8.0 software to compare the DNA sequences of the known specific genes of pathogens (also known as "pathogens"), and screened out the specific sequences of acute respiratory infectious pathogens. The acid sequence looks like this:

[0079] ①Specific sequence of cytomegalovirus (HCMV for short):

[0080] AAGTTTTGTGCCCCAACGGTACGGGCTGCAGGTAAAGTGCGATCAAGAACGCGATAACGCCGATCACAAACAGCGTGACGATGACCTGCCATCGACGGTGATTATGGCCGGCTAGACCCGTGACGCAGCTGCAGAGGCTAAAAAGCACGC;

[0081] ② Specific sequence of adenovirus (ADV for short):

[0082] CGCAGTGGTCTTACATGCACATCTCGGGCCAGGACGCCTCGGAGTACCTGAGCCCCGGGCTGGTGCAGTTCG

[0083] CCCGCGCCACCGAGACGTACTTCAGCCTGAATAACAAGTTTAGAAACCCCACGGTGGCGCCTACGCACGACGTGACCACA;

[0084] ③Specific sequence of human parainf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer group for multiple RPA detection of respiratory tract pathogens, a detection reagent and a kit. The high-specificity primer group for multiple RPA detection is successfully obtained through RPA primer design improvement of at least 5 respiratory tract pathogens of human cytomegalovirus, adenovirus, parainfluenza virus 1, parainfluenza virus 2, parainfluenza virus 3,respiratory syncytial virus, staphylococcus aureus, streptococcus pneumoniae, mycoplasma pneumoniae, chlamydia pneumoniae, klebsiella pneumoniae, acinetobacter baumannii, pseudomonas aeruginosa, stenotrophomonas maltophilia and legionella pneumophila, the detection reagent is prepared with the adoption of the primer group, and the kit is prepared, so that RPA detection of up to 15 respiratory tract pathogens can be realized according to speculation, time required for the whole detection procedure can be shortened, and steps are simplified.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a primer group, a detection reagent and a kit for multiple RPA detection of respiratory pathogens. Background technique [0002] RPA technology (full name "recombinase-mediated amplification technology") is known as a nucleic acid detection technology that can replace PCR technology. RPA technology is a technology that can rapidly amplify nucleic acid at a constant temperature. RPA technology mainly relies on three enzymes: recombinase that can bind primers, single-stranded DNA binding protein (SSB) and DNA polymerase; the optimal reaction temperature of the mixture of these three enzymes is around 37°C. The principle of RPA technology is: the protein-DNA complex formed by the combination of recombinase and primer can search for homologous sequences in double-stranded DNA. With the help of the double-stranded DNA template, the primers are paired with the homologous sequence, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/689C12Q1/6844C12Q1/10C12Q1/04C12N15/11C12R1/93C12R1/445C12R1/46C12R1/35C12R1/22C12R1/01C12R1/385
CPCC12Q1/701C12Q1/689C12Q1/6844C12Q2600/16C12Q2521/507C12Q2522/101C12Q2537/143
Inventor 陈愉生李鸿茹孙益乐许能銮郑奎城
Owner FUJIAN PROVINCIAL HOSPITAL
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More