Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

70results about How to "Shortened culture" patented technology

Novel production method for glutamic acid

The invention discloses a novel production method for glutamic acid, belonging to the technical field of the production of amino acid. The novel production method for the glutamic acid comprises the following steps of: removing thalli and insolubles by means of high-speed disc separation; evaporating and concentrating separated glutamic acid material liquid through a multi-effect plate type evaporator at low temperature, wherein the generated secondary steam condensed water is used for fermentation ingredients of the glutamic acid; performing continuous isoelectric extraction on the glutamic acid in the evaporated glutamic acid concentrated solution; absorbing the glutamic acid by making supernatant fluid pass through ion exchange columns; performing isoelectric reextraction on the analyzed glutamic acid; inputting high-concentration wastewater into a fertilizer workshop for producing fertilizer; squeezing heavy phase (mycoprotein) through a plate frame, and granulating; and drying through a fluid bed, and thus producing high-protein feed. The novel production method for the glutamic acid has the advantages of low unit consumption of liquid ammonia and sulfuric acid, high extraction yield of the glutamic acid, less ion exchange investment and the like; and meanwhile, the purity of the extracted glutamic acid is high, sodium glutamate can be produced without crystalloblast, resources are fully used in the whole process, the aims of energy conservation and consumption reduction are achieved, and the novel production method for the glutamic acid has a wide application prospect.
Owner:HULUNBEIER NORTHEAST FUFENG BIOTECHNOLOGIES CO LTD

High-efficiency method for fermentation production of L-glutamic acid

InactiveCN101402979AStimulate enzyme activityShortened cultureFermentationLow glucoseAir volume
The invention relates to a method for high-efficiency fermentation production of L-glutamic acid. The method can solve the problems of lower acid production, low glucose-acid conversion rate, and the like of the prior production process. The method comprises the following steps: a biotin auxotroph strain is taken as a production strain, according to a certain proportion, a plurality of nutritional components are prepared into a culture medium with rich and balanced nutrients as the fermentation culture medium, the dissolved oxygen is controlled on the appropriate level through the regulation of the stirring speed of a fermentation tank and the wind amount, the pH is controlled by feeding ammonia water, and the residual sugar is controlled on the lower level by feeding glucose solution with a certain concentration, and the fermentation is stopped till 32h. The method can shorten the whole fermentation cycle and greatly improve the yield (more than 150g / l) and the conversion rate (more than 60 percent) of the L-glutamic acid under the situation of not increasing any additional equipment and manpower investment, the whole process has simple operation and lower production cost, thereby being very applicable to industrial production.
Owner:TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY

Micro-fluidic chip for single cell capturing and culture

The invention discloses a micro-fluidic chip for single cell capturing and culture. The micro-fluidic chip comprises an upper cover plate and a lower substrate, wherein micro-pore arrays are respectively arranged on opposite surfaces of the upper cover plate and the lower substrate; micro-pores of the upper cover plate and the lower substrate are aligned in a one-to-one manner; the micro-pores in the upper cover plate are distributed in an independent isolation manner; the micro-pores in the lower substrate are serially connected by a micro-flow channel in the lower substrate to form a liquid channel or are connected in parallel to form a plurality of liquid channels; a liquid inlet and a liquid outlet of each liquid channel are formed in the micro-fluidic chip; a micro baffle structure is arranged at the inlet of each micro-pore of the micro-pore array on the lower substrate; the micro baffle structure is used for capturing single target cells flowing into the micro baffle structure; a gap which is greater than the diameter of one target cell is formed between the micro baffle structure and the upper cover plate; and when the micro-fluidic chip is turned over, single target cells are captured by the micro baffle structure and are limited in corresponding micro-pores in the upper cover plate. The micro-fluidic chip is capable of achieving efficient capturing and culture of single cells, and is simple to manufacture.
Owner:SHENZHEN GRADUATE SCHOOL TSINGHUA UNIV

Test tube screening method of isaria cicadae strain and culture medium

The invention relates to the field of microorganisms, and in particular discloses a test tube screening method of an isaria cicadae strain. The method comprises the following steps: collecting wild cordyceps cicadae or conidium thereof, and separating and purifying through a panel culture medium to obtain isaria cicadae single colony; picking the isaria cicadae single colony from the panel culture medium in the former step to a slope culture medium, and culturing to obtain conidium; collecting the conidium obtained from the former step, preparing spore solution, and inoculating to a test tube equipped with a test tube culture medium made of wheat; culturing and observing sporocarp, spore or hypha production condition. The test tube culture is adopted by the test tube screening method of the isaria cicadae strain, the occupied culture area is small, the operation is convenient, the culture period is short, the seed culture process in a shake flaks is not needed, the labor intensity is greatly reduced, and the energy consumption in the screening process is reduced; the wheat culture medium has good isaria cicadae strain selective culture effect.
Owner:ZHEJIANG BIOASIA PHARMA CO LTD

Stem cell repairing material as well as preparation method and application thereof

The invention relates to a stem cell repairing material as well as a preparation method and application thereof. The stem cell repairing material comprises a stem cell and a cell carrier, wherein the stem cell is an autologous adipose-derived mesenchymal stem cell (ADSC) with a concentration of 105-108 / ml, and the cell carrier is autoserum, normal saline (0.9%) or a glucose injection (5%). In the invention, adopted seed cells are prepared through separating and purifying autologous adipose tissues of patients, thereby avoiding the ethical disputes and the immunological rejection. The material drawing of the adipose tissues can be performed by using an instrument suction method, which is simple in operation and can bring less traumas and pains to the patients. The cell carrier used in the invention is the autoserum, normal saline (0.9%) or glucose injection (5%), therefore, the cell carrier mixed with mesenchymal stem cells and other ingredients can be injected into the patents by virtue of syringes. By using the stem cell repairing material provided by the invention, the operation process is simple, no scar is left, and the wounds and pains for the patients are avoided, therefore, the stem cell repairing material can be easily accepted by the patients.
Owner:王影

Efficient fermentation production process of sodium gluconate

The invention relates to an efficient fermentation production process of a sodium gluconate. The efficient fermentation production process comprises the first step of seed culturing, the second step of inoculated fermentation, the third step of continuous fermentation, the fourth step of filtering, the fifth step of decoloring, the sixth step of crystallization, the seventh of separation and drying and the eighth step of packaging. In the third step, namely, the continuous fermentation step, when the online measured concentration of a sodium gluconate reducing sugar is less than or equal to 50g / L according to the terminal stage of fermentation of the second step, a glucose liquid and a nutrient are automatically replenished by 500g / L, and simultaneously, a fermentation liquor is discharged to a buffer tank from the bottom of a fermentation tank, and meanwhile, NaOH (in a content of 350g / L) is also replenished. The continuous fermentation step of the efficient fermentation production process has the advantages that the glucose liquid and the nutrient are replenished under online automatic control, long-term continuous fermentation of the glucose is realized, the time of seed culture and fermentation liquor sterilization is saved, and the production efficiency is improved.
Owner:山东福洋生物科技股份有限公司

Haematococcus pluvialis cell growth promoting agent and use method thereof

The invention belongs to the technical field of biology, in particular to a haematococcus pluvialis cell growth promoting agent and a use method thereof. Concretely, rhodofix dissolved by ethanol and 3-seradix dissolved by hydrochloric acid are diluted into distilled water to obtain the promoting agent, wherein each liter of the solution has the rhodofix content between 0.5 and 3.0 ppm, and the 3-seradix content between 1.0 and 5.0 ppm. The obtained promoting agent is added into a culture medium of the haematococcus pluvialis cells. The invention uses the characteristic that the plant growth regulating substances have the features of promoting the cell division, the cell propagation and the growth in a certain concentration range. Through the analysis on the effect of the cell growth speed of different haematococcus pluvialis strain cells under different plant growth regulating agents and concentration matching processing, the grow promoting agent with the improved broad-spectrum effect on the haematococcus pluvialis cell growth and the proper concentration of each ingredient can be obtained through integration and optimization. The haematococcus pluvialis cell growth promoting agent of the invention has simple use method, and has the obvious promoting effect on the haematococcus pluvialis cell growth speed and the astaxanthin accumulation.
Owner:云南爱尔发生物技术股份有限公司

Listeria monocytogenes detection kit and detection method thereof

The invention relates to a device and method for detecting Listeria monocytogenes in a sample. The method mainly solves the technical problem that the prior Liseria monocytogene detection kit can detect a single sample and has complicated detection procedures and low sensitivity. The kit contains the following reagents: a reagent A, which is a sample pretreatment solution; a reagent B, which contains magnetic beads; a reagent C, which is a DNA extracting solution; a reagent D, which is a PCR reaction solution containing two pairs of specific primers which are A08650 and A08653, and A08653 andA08654. the sequences of the two pairs of specific primers are 5'GGGGAACCCACTATCTTTAGTC and 5'GGGCCTTTCCAGACCGCTTCA, and 5' GCCTGCAAGTCCTAAGACGCCAATC and 5' CTTGCAACTGCTCTTTAGTAACAGC, respectively. The method is maily used for rapid detection of Listeria monocytogeners in the sample.
Owner:SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C

Rice variety resource false smut resistance disease nursery identification method

Disclosed is a rice variety resource false smut resistance disease nursery identification method. According to the method, a disease nursery is built on a piece of paddy field which is pathogenetic all year around in a region where false smut is popular; by planting pathogenetic varieties on the disease nursery, scattering false smut balls, increasing field humidity, unevenly applying nitrogen fertilizer and the like, rice is triggered to be pathogenetic, and a good pathogenetic effect can be acquired. Compared with prior artificial inoculation, identification of a large number of variety resources can be carried out at the same time, and the workload is greatly reduced. Complex work like separation, purifying and culture of artificially-inoculated pathogenic bacteria is avoided, and the identification technical difficulty is reduced. False smut resistance of a large number of rice variety resources, new strains, new combinations and breeding materials can be identified at the same time. The method provides evidence for false smut resistance resource selection, breeding for disease resistance, rice variety certification and the like, and the risk of an outbreak of false smut in rice planting is reduced. The method has good market application prospect.
Owner:HUNAN RICE RES INST

Tissue culture method for inducing populus yunnanensis dode tetraploid in combination with colchicine

The invention relates to the technology of plant tissue culture, and in particular relates to a tissue culture method for inducing populus yunnanensis dode tetraploid in combination with colchicine. The method taking petiole of populus yunnanensis dode as a tissue culture material in the process of tissue culture is characterized by comprising the following steps of: adding colchicine into a populus yunnanensis dode petiole differential medium to induce populus yunnanensis dode to generate polyploidy, wherein the treatment time is 20-30 days; carrying out differentiation culture again in a populus yunnanensis dode petiole differential medium in which colchicine is not added after the treatment; cutting the part which is obvious in variation on the differentiated cluster buds; repeatedly cultivating on the differential medium for 5-6 times, so that the populus yunnanensis dode petiole differential medium is stable in polyploidization variation; and performing rooting on the clump seedlings which are stably varied, so that the tissue culture seedlings of the tetraploid populus yunnanensis dode can be obtained. The method provided by the invention is the tissue culture method for inducing the populus yunnanensis dode tetraploid in combination with the colchicine, which is easy and simple to operate and can effectively reduce the chimera.
Owner:SOUTHWEST FORESTRY UNIVERSITY

Recombinant escherichia coli, construction method thereof and method for producing glucaric acid by virtue of metabolic engineering

The invention discloses a recombinant Escherichia coli, a construction method thereof and a method for producing glucaric acid by virtue of metabolic engineering and belongs to the field of metabolic engineering. According to the invention, a production way of glucuronic acid is realized by expressing an inositol-1-phosphate synthase gene (Ino1) and an inositol oxidase gene (MIOX) which are sourced from plants in Escherichia coli, and a synthesis route of the glucaric acid is also successfully constructed by expressing an aldehyde acid dehydrogenase gene (Udh) sourced from Agrobacterium tumefaciens, wherein the recombinant Escherichia coli generates 2.53g / L of glucaric acid in an LB-G (10g / L of glucose is added into an LB culture medium) fermentation culture medium. The method provided by the invention for producing the glucaric acid by the recombinant Escherichia coli through fermentation has a broad development prospect and lays a foundation for biosynthesis of the glucaric acid.
Owner:SOUTH CHINA UNIV OF TECH

Method for identifying resistance of tobacco to root rot caused by Fusarium tabacinum

The invention discloses a method for identifying the resistance of tobacco to root rot caused by Fusarium tabacinum. The method comprises 1, culture of Fusarium tabacinum, 2, preparation of a Fusariumtabacinum liquid, 3, cultivation of tobacco seedlings, 4, pre-treatment on the tobacco seedlings, 5, inoculation with the Fusarium tabacinum, and 6, investigation to detect the resistance of the specie to the root rot caused by Fusarium tabacinum according to the disease conditions. The identification method can directly identify tobacco seedlings. Compared with the method for inoculation of a pot or a field with bacteria, the method is free of a complex process for pot culture after transplant, reduces work load, utilizes floating plate vaccination to inoculate with hundreds or thousands ofplants, enlarges the inoculation amount, greatly reduces identification time through direct inoculation in the seedling period, breaks the season limitation of the resistance of tobacco to root rot caused by Fusarium tabacinum and realizes identification in any seasons.
Owner:TOBACCO RES INST HENAN ACADEMY OF AGRI SCI

Microbiological method based harmlessness treatment technology for agricultural wastes generated by grape cultivation

The invention discloses a microbiological method based harmlessness treatment technology for agricultural wastes generated by grape cultivation. The method comprises steps of seed culture, liquid state fermentation and solid state fermentation. A Trichoderma strain is Trichoderma viride or Trichoderma harzianum. The invention not only provides a novel approach for harmlessness treatment and resource utilization of molasses alcohol wastes from sugarcane processing and a large amount of agricultural wastes generated by grape cultivation, besides, a solid Trichoderma agent obtained from the treatment can be applied to vineyards to increase biomass of Trichoderma for biological control in the environment, improve microecology and soil of the vineyard, inhibit pathogenic microorganisms for grapes in the microecology of the vineyard and reduce initiation factors for microbial diseases of grapes, thereby reducing application amount of pesticide, and enhancing fruit quality and security of the grapes.
Owner:GRAPE & WINE RES INST GUANGXI ACADEMY OF AGRI SCI

Microfluidic perfusion culture device and perfusion method thereof

The invention provides a microfluidic perfusion culture device, and the device comprises a fluid control unit, a culture chamber unit and a substrate liquid path unit; the fluid control unit connectsa culture medium into the substrate liquid path unit through a pump body, and the substrate liquid path unit controls liquid path selection through on-off of an electromagnetic valve, so the culture medium flows into a culture chamber; and circulating perfusion culture of the culture chamber is realized. According to the system, waste of manpower and resources can be reduced, shunting control overliquid, long-time high-flux perfusion culture of microorganisms or cells and real-time observation and detection are automatically achieved, culture and detection of the microorganisms or the cells are easy to operate, space is saved, and the system can be used in the ground or aerospace microgravity environment.
Owner:BEIJING INSTITUTE OF TECHNOLOGYGY

Preparation method of artificial seeds of submerged plants (hydrilla)

The invention relates to a preparation method of artificial seeds of submerged plants (hydrilla). The method comprises the following steps: 1. washing the taken hydrilla seedling with water to remove plankton on the surface of the hydrilla seedling; 2. cutting off the roots and leaves of all the plants, picking up the eugenic plants and washing the eugenic plants with distilled water; 3. cutting off the lateral buds and the terminal buds with internodes and putting the lateral buds and the terminal buds into gel liquid which is formed by mixing of sodium alginate, hoagland's nutrient solution and NAA (nicotinic acid amide); 4. dropping the gel liquid containing hydrilla buds into CaCl2 by a dropper to perform curing reaction, taking out gel liquid after the curing reaction and rinsing with sterile distilled water, and terminating the reaction to obtain the artificial hydrilla seeds. According to the method, the step of plant tissue culture is eliminated, and the method is not required to be implemented under an aseptic condition, the preparation process is greatly reduced, the cost is greatly reduced, the period is shortened, and the survival rate is high.
Owner:SOUTH CHINA NORMAL UNIVERSITY +1

Method for rapid separation of pathogen DNA from rice blast single scab

The invention provides a method for direct extraction of rice blast pathogen DNA from rice leaf infected by rice blast or neck blast single scab. The method of the invention can directly extract rice blast pathogen DNA from rice leaf or neck infected by rice blast, the extraction method is simple, fast and low-cost, and the extracted DNA is applicable to PCR based analysis on rice blast pathogen nontoxic gene detection and colony genetic diversity.
Owner:INST OF AGRI ENVIRONMENT & RESOURCES YUNNAN ACAD OF AGRI SCI

New method for fast selecting engineering bacteria of leaven of efficient expression antimicrobial peptides

The invention provides a new method for fast selecting engineering bacteria of leaven of efficient expression antimicrobial peptides. The method comprises the following steps: 1. constructing plasmidsfor syncretizing antimicrobial peptide genes and chaperone protein genes; 2. carrying out enzyme restriction for linearizing the plasmids; 3. transforming the plasmids to pichia competent thalli through electroporation, utilizing auxotroph for selecting, and cultivating the plasmids for 36 to 48 hours at the temperature of 28 DEG C; 4. directly obtaining transformants from a prescreening plate, i.e. obtaining the engineering bacteria of the leaven of the efficient expression antimicrobial peptides primarily, and then the engineering bacteria of the leaven can be obtained from large number oftransformants through reselection. The invention has simple experiment process and easy operation, the entire screening process can be shortened by 5 to 6 days, and the expenses of labor, materials and finical resources are greatly reduced. The invention is suitable for the engineering bacteria expressed in the leaven for proteins of the antimicrobial peptides, enzyme, antibodies, polypeptide andthe like which is not easy to or can not adopt a functional approach for selection.
Owner:HUBEI UNIV

Organic additive induced goodyera foliosa plant regeneration and efficient-propagation method

The invention belongs to rapid propagation methods for important plant materials in endangered wild plants and particularly relates to tissue culture methods for wild orchids. The invention aims at providing an organic additive induced goodyera foliosa plant regeneration and efficient-propagation method which comprises the steps of selecting and disinfecting a material, carrying out induced culture, carrying out propagation culture, carrying out root induction and transplanting, wherein a bud induction culture medium, a propagation culture medium and a rooting culture medium are involved. According to the formulae of culture media, the coefficient of propagation is large, the rooting rate is high, the plant growth required time is short, after cultivating, the adaptability is strong, and nursery-grown plants are robust, tall and straight and good, orderly and consistent in growth vigor, so that a nursery-grown plant culture process is greatly shortened, and the cost is reduced greatly; a technical support is provided for the protection and large-scale industrialized production popularization and application of goodyera foliosa.
Owner:FUJIAN AGRI & FORESTRY UNIV

Detection and detecting kit of enterorrhagia Bacillus coil 0157 nucleic acid

A nucleic acid detection method and diagnostic kit for intestinal hemorrhage bacillus coli O157. It adopts equal-length double-chain fluorogence probe technology. It is credible with high sensitivity and good specificity. The detection can be real-time operated with short periodicity.
Owner:XIAMEN UNIV

Preparation method of skin fibroblasts

The invention discloses a preparation method of skin fibroblasts, and belongs to the technical field of biological cells. The preparation method of the skin fibroblasts comprises the following steps of: S01, specimen treatment: treating a skin specimen, and removing adipose tissues and connective tissues; S02, separation: treating the treated specimen with neutral protease, and removing epidermis to obtain dermis tissues; S03, digestion: digesting the dermis tissues by using pancreatin to obtain tissue fluid; S04, centrifugation: centrifuging the tissue fluid, and removing supernatant to obtain a cell suspension; S05, culture: transferring the cell suspension into a culture dish, adding a culture solution, and culturing; and S06, passage: culturing until the fusion degree is 75-85%, and performing passage culture. The preparation method disclosed by the invention has the advantages of simple steps, low possibility of pollution, a high cell survival rate, a good purification effect and small cell loss.
Owner:郑州源创基因科技有限公司

Rapid propagation method for clustered shoot through induction of aerial root of Anthurium andraeanum Lind

The invention provides a rapid propagation method for a clustered shoot through induction of the aerial root of Anthurium andraeanum Lind. The method comprises the following steps: 1) selection of an explant; 2) induction culture of reproduction block mass; 3) induction culture of a clustered shoot; 4) propagation of the clustered shoot; and 5) acclimatization and transplant, wherein an obtained seedling is transplanted into a pot in two months so as to obtain a tissue culture seedling bred by using the method of propagation of the clustered shoot through induction of the aerial root of Anthurium andraeanum Lind. According to the invention, the method overcomes the disadvantages of a low propagation coefficient and a complex rooting culture method in induction of a clustered shoot through reproduction block mass in the prior art; hormones consisting of TDZ and NAA are utilized to induce regeneration of the clustered shoot from the aerial root of Anthurium andraeanum Lind, so a high propagation coefficient is realized, rooting and acclimatization procedures are simplified, the reproduction block mass of the aerial root has superior differentiation capability and anti-aging capability compared to calluses induced by different materials, the purposes of a fast propagation speed and conservation of production cost are achieved, and the method is applicable to large scale seedling growing in a factory.
Owner:CHINA THREE GORGES CORPORATION +1

Pestalotia funereal pathogenic bacteria molecule detection kit and use method thereof

The present invention discloses a Pestalotia funereal pathogenic bacteria molecule detection kit and a use method thereof. The kit comprises the following components: 16 muL of ultra pure water d.d.H2O, 2 muL of an upstream primer F (5'-3') (GTCAACCAGCGGAGGGAT), 2 muL of a downstream primer R (5'-3') (CGCCGTTGTATTTCAGGAG), and 25 muL of Premix. With the present invention, rapid Pestalotia funereal detection can be achieved, sensitivity is high, the kit can be used in early plant disease detection, and strong technical supports are provided for development of targeted Pestalotia funereal prevention and control and Pestalotia funereal problem solution in time.
Owner:SICHUAN AGRI UNIV

N<15> stable isotope labeling method for biological protein quantifying and tracing

The invention discloses an N<15> stable isotope labeling method for biological protein quantifying and tracing. The method comprises the steps that yeast is utilized for converting an N<15> inorganic salt into biological protein, wherein when the culture passage number of the yeast reaches 6 or above, 98% or above of protein extracted from the yeast is N<15> protein; the high-purity N<15> protein extracted from the yeast is converted into N<15> yeast peptone, the N<15> yeast peptone is utilized for replacing conventional N<14> yeast peptone to be used for culturing multiple organisms, and specific N<15> isotope labeling is provided for biological protein labeling quantifying and tracing. The method can be applied to more organism varieties and is easy and convenient to operate, low in experimental cost and short in test cycle, and people can conduct proteome analysis on a large number of samples in an efficient and low-cost mode conveniently.
Owner:广州微因生物科技有限公司

Method for producing coenzyme Q10 by industrial fermentation

The invention relates to a preparation method of coenzyme Q10, in particular to a method for producing coenzyme Q10 by industrial fermentation. A strain used in the method is Rhodobacter sphaeroides.The method includes the following steps: plate culture of the strain, inclined plane culture of the strain, 20 L seed culture, primary seed tank culture, secondary seed culture, tertiary fermentationculture, seed-pouring culture and fermentation. The method can solve problems that a culture medium in fermentation liquor is incompletely consumed and the fermentation liquor has high impurity content, low effective units, and accordingly low in refining yield, the quality of industrial salt is not easy to control, low-unit hyphae causes low yield and high sewage discharge, and unused organic matter in emissions causes excessive COD emissions, thereby increasing environmental protection costs. The method has simple process flow and low bacteria contamination risk, saves fermentation cost, improves fermentation output, increases process reserves, and increases production scheduling.
Owner:SHENZHOU BIOLOGY & TECH CO LTD

RNA probe for detecting novel coronavirus 2019-nCOV as well as preparation method and application thereof

The invention discloses an RNA probe for detecting novel coronavirus 2019-nCOV as well as a preparation method and application thereof, and belongs to the technical field of nucleic acid hybridization. In order to improve the accuracy and specificity of novel coronavirus detection, the invention provides the RNA probe for detecting novel coronavirus 2019-nCOV, and the nucleotide sequence of the RNA probe is shown as SEQ ID No.1. The preparation process comprises the following steps: primer designing, construction of recombinant plasmids, PCR amplification, product purifying, and in-vitro transcription. When the prepared probe is applied to detection of 2019-nCOV, 2019-nCOV virus nucleic acid can be detected at a single cell level, and the detection sensitivity is improved.
Owner:湖南寰宇新材料科技股份有限公司

Preparation method and application of phi29 DNA polymerase

InactiveCN106367407AHigh Synthetic SustainabilityHigh strand displacement activityTransferasesFermentationPlasmid dnaPronucleus
The invention discloses a preparation method and application of phi29 DNA polymerase and specifically relates to application of the phi29 DNA polymerase in preparation of a template plasmid of DNA Marker. The method comprises the following steps: construction of the pronucleus of the phi29 DNA polymerase; screening of expression strains; purification of phi29 recombinant protein; etc. A medium is inoculated with the strain; after inducible expression, thalli are collected; and the thalli are subjected to breaking and purifying so as to obtain the phi29 DNA polymerase. When the phi29 DNA polymerase is applicable to preparation of plasmid templates, a series of cumbersome steps like cell culture, collection and cracking of bacteria, and separation and purification of plasmid DNAs can be omitted; an initial sample of a nanogram magnitude can be amplified to obtain DNAs of a microgram magnitude; and the method has the advantages of simple steps, conservation of time, high efficiency, low cost, etc.
Owner:NOVOPROTEIN SCI INC

Method for producing fermentation product

The invention discloses a method for producing a fermentation product. The method comprises the following steps of: evaporating fermented mash so as to obtain gas-phase material flow mainly containing the fermentation product and liquid-solid mixture flow mainly containing thalli of a fermentation strain; and separating the thalli of the fermentation strain contained in the liquid-solid mixture flow out and recycling the separated thalli in a fermentation process. The method provided by the invention has the advantages of overcoming the defects of the conventional typical process, recycling most fermentation organisms (such as saccharomycetes) in the fermentation process, reducing the culturing of seed liquor, directly obtaining most fermentation products by evaporating, saving energy consumption and lowering separation cost.
Owner:德国ACS农业化学系统GMBH公司 +1

One-step Seedling Cultivation Method of Wheat Anthers

The invention discloses a one-step seedling cultivation method for wheat anthers. Wheat young ears whose pollen cells develop to the mid-monocytic stage to the late monocytic stage are selected and pretreated at low temperature (2°C to 4°C) for 2 days; the pretreated wheat Young ears, after routine disinfection, strip the anther tissue and inoculate it on the one-step seedling medium for shading cultivation; when the cultured anther tissue appears callus visible to the naked eye, it is placed under 1500Lx light conditions for one week and then the light intensity is reduced. Increase to 3000Lx ~ 4000Lx, continuous cultivation for two weeks, can produce robust pollen plants with roots and seedlings. The method reduces two necessary technical operation links for inducing adventitious buds and adventitious roots by pollen callus, reduces the culture cost by nearly 50%, shortens the culture days by 40-50 days, and the average induction rate of green seedlings is comparable to the greenness of multi-step seedlings. The average induction rate of the seedlings was the same, the white seedling rate was generally reduced by 10%, and the test-tube seedlings grew robustly, the root system was developed, and there was little or no callus residue in the rhizome connection part, and the transplanted seedlings had a high survival rate.
Owner:NORTHWEST A & F UNIV

Method for direct extraction of pathogen DNA from pathogenic tissue of Graminaceous crop

The invention provides a method for direct extraction of pathogenic fungus and bacteria DNA from leaf scabs of gramineous crops such as pathogenetic rice and corn. The method of the invention can directly extract pathogen DNA from leaf and neck of rice and corn leaf scabs infected by rice blast, the extraction method is simple, fast and low-cost, and the extracted DNA is applicable to PCR based analysis on pathogenic organism molecular detection and diagnosis, pathogen nontoxic gene detection and colony genetic diversity.
Owner:INST OF AGRI ENVIRONMENT & RESOURCES YUNNAN ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More