365 results about "Vibrio fluvialis" patented technology

The invention discloses a Schizochytrium sp., which has a category name of Schizochytrium sp., is preserved in Common Microorganisms Center of China Committee for Culture Collection of Microorganisms and has a preservation number of CCTCC No.209059. The invention also discloses a method for producing DHA lipa by using the Schizochytrium sp. The method optimizes a strain fermentation medium from the perspectives of osmotic pressure and element supply and combines a fed-batch strategy to achieve high-density fermentation of microalgae, thus the final dry cell weight reaches 70 grams per liter, the lipa content reaches 31.5 grams per liter, and the DHA accounts for more than 35 percent of the total fatty acid content. All indexes of the DHA essential oil obtained by the method accord with the standard of food additives, and the DHA essential oil contains a bioactive substance of squalene. The method has the advantages of simple entire process, convenient operation, and high biomass and DHA content, reduces the fermentation cost, and is suitable for industrial production.

The invention discloses an application of bdellovibrios in removing pathogenic vibrio in marine food products and the culture water. The bdellovibrio concentrated solution is added into the marine food products and / or the culture water so as to lead the concentration of the bdellovibrio to reach at least 10<2>pfu / ml. When the invention is applied before eating the marine food products, in the transportation process and in the culture water, the concentration range of bdellovibrio is respectively 10<4>-10<12> pfu / ml, 10<3>-10<11> pfu / ml, and 10<2>-10<6 > pfu / ml. More than 90% pathogenic vibrio carried by marine food products before eating and / or in the transportation process is cleared by adopting a biological method, and the pathogenic vibrio in the culture water can also be controlled within10cfu / ml. The invention is suitable for the pretreatment process before being eaten or processed, the transportation process and the culture process of marine food products, especially facilitating the reduction or elimination of chemical medicine residues such as antibiotics, thus fundamentally avoiding the occurrence of food poisoning of the marine food products.

The invention relates to six oligonucleotide sequences and an application thereof, relating to the recognition detection of vibrio alginolyticus. The invention provides six oligonucleotide sequences capable of inactivating the recognition detection of vibrio alginolyticus, a preparation method and an application thereof. The oligonucleotide sequence has the characteristics of being quick in detection, simple in operation, superior to that of antibody and the like in stability, and the preparation method is easy and relatively short in preparation period. The six oligonucleotide sequences comprise oligonucleotide sequences of SEQ ID No.1-6, and the recognition detection of vibrio alginolyticus can be inactivated by adopting one of the oligonucleotide sequences. The preparation method comprises the following steps: synthesizing an ssDNA oligonucleotide library used for filtering; carrying out SELEX filtering after the oligonucleotide library is mixed with inactivated vibrio alginolyticus till the affinity is not raised obviously; then cloning and sequencing; and selecting a highly copied ssDNA thereof to carry out verification of affinity specificity and determination of affinity constants so as to obtain corresponding an aptamer. The six oligonucleotide sequences can be used for recognition detection of inactivated vibrio alginolyticus.

The invention discloses bacillus pumilus, a probiotics preparation and a preparation method and application thereof. The Bacillus pumilus LV149 is preserved in China center for type culture collection (CCTCC) in Nov. 23th, 2011, and the preservation number is CCTCC NO: M 2011411. The bacillus pumilus LV149 has strong extracellular protease, lipase and amylase activities, has wide rejection capability to vibrio and has no hemolytic activity. The Bacillus pumilus LV149 serves as fermenting bacterial strains and is performed with solid fermentation, drying and smashing so as to prepare bacillus pumilus probiotics preparation which uses Bacillus pumilus LV149 as the active ingredients. The bacillus pumilus probiotics preparation can be added into prawn feeds for feeding prawns, so that growth of prawn intestinal pathogenic vibrio can be restrained, prawn vibriosis can be reduced, simultaneously prawn growth is promoted, fish bait coefficient is reduced, quality of commodity is improved, culture cycle is shortened, accordingly culture risk and culture cost are reduced, biological safety is high and the bacillus pumilus, the probiotics preparation and the preparation method and application thereof have wide application prospect in aquaculture.

The invention discloses a LAMP (loop-mediated isothermal amplification) detection kit for Vibrio vulnificus and a detection method using the same, and particularly relates to a group of primers for detecting Vibrio vulnificus, a kit containing the primers and a detection method using the same. The primers have oligonucleotide sequences shown as SEQ ID NOs.1-6 in a sequence table. The kit disclosed by the invention is high in sensitivity and specificity, low in cost and simple to operate.

The invention relates to a Vibrio bacteriophage and a bactericidal composition preparation method and application thereof, belonging to the field of biotechnology. The bacteriophage composition comprises Vibrio alginolyticus bacteriophage vB_ValS_PcR-1 (accession number being CCTCC NO: M 2018391), Vibrio harveyi vB_VhaM_PcB-1G (accession number being CCTCC NO: M 2018392) and Vibrio parahaemolyticus phage vB_VhaP_OW (accession number being CCTCC NO: M 2015577). A high-potency culture product can be obtained after host actions, the composition is good in stability at room temperature, has a widehost splitting range, can efficiently inhibit growth of main pathogenic vibrios such as vibrio alginolyticus, vibrio harveyi, vibrio parahaemolyticus, can be applied as a biological antimicrobial agent for vibrio contamination control in food and aquaculture.

The invention discloses three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as a preparation method and an application thereof and relates to identification and detection of vibrio alginolyticus. The oligonucleotide sequences comprise SEQ ID No. 1-3 (sequence identity number 1-3). The method comprises the following steps: synthesizing an ssDNA (single-stranded deoxyribonucleic acid) oligonucleotide library (5'-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCA CAA GAG GGA GAC CCC AGA GGG-3') for screening; mixing the oligonucleotide library with the vibrio alginolyticus and then performing SELEX (systematic evolution of ligands by exponential enrichment) screening; performing cloning and sequencing on an aptamer-enhanced library after completing the SELEX screening; performing interception in different lengths on high-copy ssDNA emerged in the sequencing result so as to get a series of new sequences, and further constructing complementary sequences of the new sequences; and performing affinity and specificity verification on the obtained new sequences and the complementary sequences thereof so as to get corresponding aptamers.

The invention discloses an oligonucleotide sequence for detecting vibrio alginolyticus and application thereof. The oligonucleotide sequence for detecting vibrio alginolyticus comprises four oligonucleotide sequences, such as SEQIDNo.1, SEQIDNo.2, SEQIDNo.3 and SEQIDNo.4, and the vibrio alginolyticus can be identified and detected by one oligonucleotide sequence. The oligonucleotide sequence disclosed by the invention has the characteristics that the detection is rapid, the operation is simple and the stability of an adaptor is higher than that of an antibody, is easy to prepare and has shorter preparation period.

The present invention relates to a detection chip for performing gene detection to various vibrio and its detection and applications. The invention provides 16S rRNA sequences corresponding to each vibrio of vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, vibrio parahaemolyticus, brilliant vibrio and Fisher vibrio; heat shock protein hsp60 probe sequence; virulence gene probe sequence; 16S rRNA forward primer sequence; 16S rRNA reverse primer sequence; heat shock protein hsp60 forward primer sequence; heat shock protein hsp60 reverse primer sequence; virulence gene forward primer sequence and virulence gene reverse primer sequence. The present invention has specific, sensitive and high-throughput features, can simultaneously detect six kinds of bacteria virulence genes, and the invention will effectively guide the production as an important disease early-warning detection method used in clinical diagnosis of aquatic animals.

The invention provides bacillus subtilis (Bacillussubtilis) shou003, an anti-vibrio protein and a preparation method and applications of the bacillus subtilis shou003 and the anti-vibrio protein. The preparation method of the anti-vibrio protein comprises the following steps: screening out bacillus subtilis shou003 (preserved in China Center for Type Culture Collection with a number of CCTCC No.: M2013571 on November 13, 2013) from intestinal tract of a healthy large yellow croaker; and then extracting the anti-vibrio protein from the fermentation broth of bacillus subtilis shou003, wherein the amino acid sequence of the anti-vibrio protein is shown as SEQ ID No.: 1. The bacillus subtilis shou003 and the anti-vibrio protein show good effects on inhibiting aquatic pathogenic bacteria, in particular pathogenic vibrio; in addition, the bacillus subtilis shou003 shows outstanding tolerance to temperature, NaCl, gastric juice, intestinal juice and cholate and can be widely applied to the prevention of germs during aquaculture; on that basis, the optimal fermentation culture method of the bacillus subtilis shou003, and a preparation method of the anti-vibrio protein are provided.

The invention discloses a gene chip of aquatic product cultivation pathogenic bacterium, comprising a solid phase carrier which is modified chemically, a detection probe and a quality control probe are distributed on the solid phase carrier in a dot matrix way; the detection probe comprises specificity 16S rDNA sequences and / or gyrB gene sequences of vibrio, comma bacillus, vibrio harveyi, vibrio alginolyicus, vibrio anguillarum, vibrio parahemolyticus, nocardia, nacardia seriolea, aeromonas, hydrophilic aeromonas, streptococcus and dolphin streptococcus, which are to be detected, the quality control probe includes PCR positive, chip fixed positive control, chip hybridizing negative control, chip hybridizing positive control and chip hybridizing blank control; the gene chip has the advantages of small volume and high flux, can detect known and unknown germs of the vibrio, the nocardia, the aeromonas and the streptococcus, and can detect specific germs with multiple kinds, and the simpleness and rapidness and specificity of the germs can be detected, and automatic detection can be carried out after detection software is additionally arranged.

The invention relates to bifidobacterium longum subsp. infantis CCFM687 as well as fermented food and application thereof. The bifidobacterium longum subsp. infantis CCFM687 provided by the inventioncan improve the depressive behavior of a depression mouse and raise the level of 5-hydroxytryptamine, 5-hydroxytryptophane and brain-derived neurotrophic factor in the brain of the depression mouse; moreover, the content of butyric acid in the intestines of the depression mouse is increased; the abundance of intestinal desulfovibrio is lowered while the abundance of bifidobacterium and S24-7 family is raised, the intestinal flora alpha-diversity is improved, the intestinal flora disturbance of the depression mouse is relieved, and the occurrence of autism, inflammatory bowel disease, obesity,diabetes mellitus type I and the like is reduced; the level of mRNA simulating tryptophan hydroxylase in enterochromaffin cell is raised, the secretion of 5-hydroxytryptophane of the enterochromaffincell is increased, and a precursor substance is provided for the synthesis of 5-hydroxytryptamine in brain. Therefore, the bifidobacterium longum subsp. infantis CCFM687 has a broad application value.

The present invention relates to reagent kit and process for detecting Vibrio vulnificus in circular mediate constant temperature amplification method. The reagent kit includes: circular mediate constant temperature amplification reactant liquid A with upstream inner primer tgccactcggctacgataacgtttttgagctgtcacggcagttg, downstream inner primer acgcagacaaaacgctcacagtttttgagcttatcgccttcccaat, upstream outer primer tggttcggttaacggctg and downstream outer primer gccatcaacatagcggctaa; and 1-1.5 M beetaine. The detection process includes the following steps: extracting bacterium DNA, circular mediate constant temperature amplification of Vibrio vulnificus, color developing detection, etc. The present invention has the advantages of high speed, high specificity, high sensitivity and low cost.

The invention relates to a method for constructing a specific pathogen-free penaeid shrimp culture system, which comprises the steps of adopting comprehensive treatment of culture water for avoiding the entry of pathogens; introducing selected oocystis borgei into a penaeid shrimp culture pond for constructing a good microalgae community structure, and using a microalgae-controlled water environment to reduce the concentration of injurious factors, such as ammonia nitrogen, nitrite nitrogen and the like in a water body, improving the water quality, eliminating stress factors, improving the content of dissolved oxygen in the water and leading the environment of the water body to be in the good dynamic balance state for a long time. A system of the oocystis borgei, rhodopseudanonas palustris and phycomycete is utilized for inhibiting the growth of vibrios during the early stage, the middle stage and the late stage of culture; and schmackeria dubin is utilized to intake microalgae, thereby controlling the number of the microalgae in the water body and eliminating the adverse impacts of rapid proliferation of the microalgae on a culture environment. Penaeid shrimps have the advantages of specific pathogen-free property, rapid growth, strong disease resistance, strong stress resistance, short culture period, large and uniform formed size, high output, good investment efficiency and the like.

An isolated strain of bacteriophage, specific against bacteria belonging to the Vibrio genre, particularly the anguillarum species, deposited on 3 Oct. 2012 at the Polish Collection of Microorganisms (PCM) of the Ludwik Hirszfeld Institute of Immunology and Experimental Therapy of the Polish Academy of Sciences, with access number F / 00072, characterized in that said strain is efficient in the prophylaxis, control and / or treatment of the infection caused by Vibrio anguillarum in all types of species of fish, mollusks and crustaceans that are important for aquaculture susceptible to this bacteria, genome size 48.6 Kb, it is not sensitive to chloroform and its storage temperature is −80° C.

The invention relates to a Vibrio FC509 strain and a culturing method and application thereof. The Vibrio FC509 strain is collected in the China General Microbiological Culture Collection Center (CGMCC) on 12, March, 2014, with a collection number of CGMCC NO.8913 and an address of Institute of Microbiology Chinese Academy of Sciences NO.1 West Beichen Road, Chaoyang District, Beijing. The Vibrio sp. FC509 strain obtained by first-time separation is capable of preparing glycosaminoglycan lyase which has a specific activity of 110,000U / mg to hyaluronic acid and specific activity of 45,000U / mg to chondroitin sulfate; enzyme activity is tens to hundreds times that of the known commercialized glycosaminoglycan lyase, can be applied to fields such as medicines, cosmetics and the like, and is wide in application prospect.

The invention relates to separation of Bacillussubtilis and application of the Bacillussubtilis in raising Apostichopus japonicus. The Bacillussubtilis can effectively inhibit vibriones and other pathogenic bacteria from breeding, and promote the growth of the Apostichopus japonicus. The strain is separated from gills of fished captured in the Dalian sea area, and is preserved by China General Microbiological Culture Collection Center with the collection number of CGMCC No.3498. The Bacillussubtilis can be widely applied to breeding and production links in the fishery industry, can degrade, convert and metabolize metabolic products in the breeding and production processes, creates good ecological environment, and improves, preserves and repairs the ecological environment of water resources to fulfill the aims of reducing self-pollution, reducing medicinal harm, reducing cost, lightening the pollution of the aquaculture to the whole ecological environment and improving the quality of cultured products.

The invention discloses a microbial preparation, an aquatic feed and an aquaculture method and relates to the technical field of aquaculture. The microbial preparation comprises bdellovibrio and probiotic. Optimally, the probiotic is selected from any one of lactobacillus bulgaricus, lactobacillus delbrueckii, enterococcus faecalis, lactobacillus casei, lactobacillus acidophilus, rhodopseudomonaspalustris, clostridium butyricum, bacillus laterosporus, bacillus pumilus, bacillus coagulans, bacillus licheniformis, bacillus subtilis and lactobacillus plantarum. The microbial preparation has thecharacteristics of capability of increasing food intake of aquaculture animals, capability of promoting growth rate, survival rate and immunity of organisms, and the like. Besides, the microbial preparation is capable of effectively preventing and treating the problems of diseases caused by pathogenic bacteria, such as vibrio parahaemolyticus, vibrio harveyi, luminous vibrio, vibrio alginolyticus,vibrio campbellii, vibrio fluvialis, vibrio vulnificus, aeromonas, vibrio cholerae, pseudomonas and salmonella.

The invention discloses a vibrio-splendidus-resistant egg yolk antibody and a preparation method thereof. The vibrio-splendidus-resistant egg yolk antibody is obtained from a vibrio splendidus immunized laying hens, has features of good specificity and high titer, is used for preventing and treating diseases caused by vibrio splendidus and immunological detection, and has good effects. The vibrio-splendidus-resistant egg yolk antibody is obtained by extracting hyperimmune eggs laid by the vibrio splendidus immunized laying hens, blood sampling is not required, immunized animals are not injured, and modern animal rights protection rules are met; and each egg contains more than 100mg of the vibrio-splendidus-resistant egg yolk antibody approximately, and 3g of the vibrio-splendidus-resistant egg yolk antibody can be obtained in a month, and is 10-20 times greater than an antibody extracted from blood of an immunized rabbit. The vibrio-splendidus-resistant egg yolk antibody has the advantages of safety, environmental protection, high efficiency, low cost and the like, and is easy to industrialize.

The invention relates to a nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 serotypes and an application thereof. The nucleotide comprises 1) at least one of nucleotides shown in SEQIDNO: 1-14; and 2) at least one of nucleotides shown in SEQIDNO: 1-14. The nucleotides can be used for preparing PCR (polymerase chain reaction) kits and gene chips for detecting Vibrio fluvialis. The nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 serotypes disclosed by the invention, as well as a PCR kit and a gene chip which contain the nucleotide, are strong in practicability, and the PCR kit is simple in preparation method, short in detection cycle, rapid in speed, strong in maneuverability, convenient for industrialized production, and low in detection cost; the accuracy is high; and the sensitivity is high.

The first primer of the invention is a primer which, when used in PCR under appropriate conditions, serves to detectably amplify 16S rRNA-encoding DNAs of bacteria of the Escherichia, Salmonella and Vibrio genera, but when used in PCR under the same conditions, does not serve to detectably amplify either chloroplast 16S rRNA-encoding DNAs or mitochondrial 16S rRNA-encoding DNAs. The second primer of the invention is a primer which, when used in PCR under appropriate conditions, serves to detectably amplify 16S rRNA-encoding DNAs of Staphylococcus aureus and Bacillus cereus, but when used in PCR under the same conditions, does not serve to detectably amplify either chloroplast 16S rRNA-encoding DNAs or mitochondrial 16S rRNA-encoding DNAs.

The invention relates to the technical field of functional microbiological screening and provides novel Bacillus licheniformis DN29 which is collected under CCTCC NO: M2015482. The Bacillus licheniformis DN29 obtained by screening can effectively inhibit pathogenic bacteria such as Vibrio splendidus and pseudoalteromonas, can reduce disease probability of bred animals and can serve as a feed additive to remarkably increase feed utilization rate of the bred animals and promote growing of the animals. The Bacillus licheniformis DN29 can serve as a probiotic to be applied in the process of rearing and producing Stichopus japonicus, has remarkable promoting effect on growing of Stichopus japonicus and can effectively improve immunity of and resistance, to Vibrio splendidus, of Stichopus japonicus.

The invention discloses a compound Chinese herbal medicine immunopotentiator of Penaeus vannamei Boone. The compound Chinese herbal medicine immunopotentiator comprises 5-30% of bark of eucommia, 5-40% of radix astragali, 5-30% of honeysuckle flower, 5-30% of radix bupleuri, 5-30% of giant knot weed, 5-30% of phellodendron, 5-30% of licorice root, 5-30% of epimedium, 2-20% of Chinese magnoliavine fruit and 2-20% of pilose asiabell root. The compound Chinese herbal medicine immunopotentiator of Penaeus vannamei Boone replaces an antibiotic, promotes Penaeus vannamei Boone growth, improves immunity and reduces diseases. Through use of 0.5-3.0% of the compound Chinese herbal medicine immunopotentiator in forage, a Penaeus vannamei Boone growth speed is improved by 5-15%, a forage coefficient is reduced by 0.05-0.2, immunity and low-oxygen tolerance of Penaeus vannamei Boone are improved, and Penaeus vannamei Boone mortality caused by vibrio alginnolyficus is reduced.

The invention discloses a quadruple fluorescent PCR kit for detection of pathogenic vibrios in a water body and a detection method. According to the method, innovative bacterium enrichment reagent technology, DNA extraction reagent technology, specific fluorescent probe hybridization PCR detection technology and multiplex PCR technology are employed, bacterium enrichment culture of a sample is not needed, false positive interference is minimized as much as possible on the premise that high sensitivity is maintained, and four kinds of vibrios can be detected at one time. The invention mainly has the following beneficial effects: no need for bacterium enrichment of the sample in advance; high sensitivity and good specificity in detection of bacteria; reduction of the false positive incidence in conventional PCR amplification; and realization of rapid, accurate and specific detection of vibrio vulnificus, vibrio alginolyticus, vibrio mimicus and vibrio flurialis at one time.

The present invention is preparation and usage of outer membrane protein subunit morbid vibrio vaccine for seawater fish. The vaccine is prepared through extracting two or more of Vibrio alginolyticus, Vibrio Hrveyi, Vibrio vulnificus, Vibrio parahaemolyticus, etc, and adding immunostimulating complex. The vaccine preparing process includes culturing vibrio, extracting outer membrane protein and preparing vaccine. The vaccine containing partial pathogen and no infecting component has stable immunological specificity and no hidden danger of restoring toxici. The vaccine is used in preventing fishes' skin ulcer, eyeball turbidity and other vibrio caused diseases and may be used widely for immunizing seawater fish.

The invention provides a method for detecting fluorescent quantitative PCR of 12 pathogenic bacteria in real time at the same time, including the steps: collecting specific pathogenic gene or toxin gene of the target pathogen and using it as a target gene to design primers and probes so as to make the reaction conditions consistent; extracting a genome template of a sample to be detected; adding the template respectively into tubules equipped with different specific upstream and downstream primers and probes, and then adding the corresponding fluorescent quantitative PCR reagents; under the same cycle of fluorescent quantitative PCR, the corresponding primers and probes are used to detect the samples simultaneously, quickly and quantitatively in their respective reaction tubes. Easier, Quick and efficient, Twelve common pathogenic bacteria (Escherichia coli O157: H7, Listeria monocytogenes, Salmonella, Vibrio parahaemolyticus, Streptococcus betae, Yersinia enterocolitica, Streptococcusfaecalis, Shigella, Proteus mirabilis, Vibrio fluvialis, Campylobacter jejuni, Staphylococcus aureus) can be detected simultaneously in drinking water and food economically.

The present invention discloses one kind of multiple PCR reaction reagent kit for detecting marine vibrio and its detection method. The multiple PCR reaction reagent kit includes PCR reaction solution compounded with 10xPCR reaction buffering solution containing Mg2+, dNTP, Hot star Taq enzyme, pathogenetic vibrio DNA primer and sterilized ion solution. The pathogenetic vibrio DNA primer includes DNA primers of three kinds of vibrios. The present invention may be used in detecting these three kinds of vibrios in short time and lowered cost and is favorable to the diagnosis of vibriosis of marine animal.

The invention discloses a universal gene-knockout suicide vector for vibrios and a construction method theroef and provides an application thereof in gene knockout of the vibrios. The universal gene-knockout suicide vector pLP12 is a ring-shaped vector and comprises a PBAD promoter, a repressor protein gene araC, an RP4 transferring initiation site, a chlorampenicol resistant gene, an R6K duplicating initiation site, a multiple-cloning-site area and a lethal gene vmi480; the multiple-cloning-site area at least contains two AhdI restriction enzyme digestion sites; the suicide vector pLP12 is subject to AhdI restriction enzyme digestion to form linearized suicide vector pLP12T. The universal gene-knockout suicide vector adopts entirely-new reverse selection genes vmi480 and is used for replacing the common sacB gene. Foreign fragments carried by the pLP12T are transferred to vibrio cells to be mutated by a jointing mode, under the pressure of antibiotics and reverse selection of products of lethal gene vmi480, first-time homologous recombination and second-time homologous recombination are carried out on the vibrios successively, and finally the mutant strain with deletion of target genes is generated.

The invention relates to a method for enriching vibrio phage and biologically preventing host bacteria. Due to splitting specificity of the phage, the phage of the specific host strains in the specific environment and a certain state cannot be obtained easily. According to the facts that the vibrio strains and the phage of culture zones and sea areas coexist with the environment ecologically and evolutionally, a long-term culture pool of the host bacteria and the phage is built in a specific area, lytic phage of specific pathogenic bacteria hosts in the area can be continuously enriched and separated, the lytic phage can be placed in the area after augmentation, proliferation of pathogenic bacteria of a cultivation water body can be controlled in a short time, concentration of the pathogenic bacteria of the water body can be restrained in a long term, and the effect of ecological defense is achieved. The method utilizes the phage in the cultivation sea water body to prevent diseases caused by the pathogenic bacteria and has the advantages of being efficient, ecological, safe, safe and lasting.