583 results about "Vibrio parahemolyticus" patented technology

The present invention demonstrated the potential use of Lactobacillus johnsonii D115 as a probiotic, as a prophylactic agent or as a surface treatment of materials against human and animal pathogens such as Brachyspira pilosicoli, Brachyspira hyodysenteriae, Shigella sonnei, Vibrio cholera, Vibrio parahaemolyticus, Campylobacter jejuni, Streptococcus pneumoniae, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Yersinia enterocolitica, Escherichia coli, Klebbsiella pneumoniae, Staphylococcus aureus, Salmonella spp., Bacillus cereus, Aspergillus niger and Fusarium chlamydosporum. The proteineous antimicrobial compound was partially characterized and found to be heat tolerant up to 121° C. for 15 min, and acid tolerant up to pH1 for 30 min at 40° C. The compound is also stable to enzymatic digestion, being able to retain more than 60% antimicrobial activity when treated with pepsin and trypsin.

The invention relates to bacillus amyloliquefaciens NCPSJ7 and further relates to an application of the strain in treating plant diseases, diseases before and after harvesting fruits and vegetables as well as in preventing food-borne pathogenic bacteria and putrefying bacteria. The strain is preserved in China Center for Type Culture Collection (CCTCC) on March 22, 2013, wherein the preservation number is CCTCC NO: M2013098 and the strain is named as bacillus amyloliquefaciens NCPSJ7. The thallus and fermentation liquor of the strain disclosed by the invention has the effects of treating plant diseases caused by plant pathogenic fungus including antagonistic peach root rotten disease, fusarium wilt of cucumber, botrytis cinerea, jujube anthracnose, pear black spot, pear blue mould, apple brown rot, apple altermaria leaf spot, watermelon fusarium wilt and the like, as well as diseases after harvesting fruits and vegetables and food-borne pathogenic bacteria and putrefying bacteria including antagonistic staphylococcus aureus, salmonella paratyphi A, vibrio parahaemolyticus, yeast and the like; moreover, the bacillus amyloliquefaciens is broad in spectrum and antibacterial and great in potential in developing novel, efficient and natural biological control and biological preservative and fresh-keeping preparation.

The invention relates to a vibrio parahemolyticus detection kit. The vibrio parahemolyticus detection kit is characterized by comprising the following components: (1) an immune enrichment reaction system component, (2) a loop-mediated isothermal amplification (LAMP) system component and (3) a set of specific primers based on an LAMP technology of vibrio parahemolyticus tlh genes, wherein the specific primers comprise two outer primers F3 and B3, two inner primers FIP and BIP and two ring primers LF and LB. The detection method for the vibrio parahemolyticus detection kit comprises the following steps of: detecting the vibrio parahemolyticus by adopting a method of combining immune enrichment and the LAMP technology; preparing an immunomagnetic bead by adopting a vibrio parahemolyticus polyclonal antibody; preliminarily screening the vibrio parahemolyticus in an actual sample by adopting an immunology method; and designing an LAMP specific primer according to the species specificity gene of the vibrio parahemolyticus. According to the invention, molecular detection is carried out on a nucleic acid level, therefore, the condition of false positive or undetection of a simple immunology method or a molecular method is effectively avoided, and the invention is a new development direction of the quick detection of the vibrio parahemolyticus.

The invention relates to a kit checking vibrio parahaemolyticus with mediated isothermal amplification technology and the method. Said kit comprises LAMP reacting liquid A, downstream inner primer DNA polymerase B and coloured solution; and the upstream inner primer in LAMP reacting liquid A is tctggtcagcaagcagcagttttttcgccgaccacatttctca; downstream inner primer is acccgtactatccaactgcgcttttggcgcgtacttagcaagg; upstream outer primer is ccaagcgtttcgtcacca; downstream outer primer is caaagctttgtgcgaactcg. The checking method comprises extracting bacteria DNA, mediated isothermal amplification for vibrio parahaemolyticus, and coloring detection. The invention is characterized by fast speed, strong specificity, high sensitivity and low cost.

The invention relates a technique for fast detecting food-borne pathogens based on a loop-mediated isothermal amplification, LAMP technique. A primer for diction of vibrio parahemolyticus can augment the specific base sequence of a target gene which is the tih-GenBank (accession no. AY578148) of the vibrio parahemolyticus, and the primer is complementary to a part of or a complementary chain fragment of the nucleic acid sequence on the 946-1140 loci on the target gene. The invention provides a primer having specificity to a specific gene fragment of the vibrio parahemolyticus, and through detecting whether or not the detecting specimen in a reagent box of the primer unit contains the specific gene fragment of the vibrio parahemolyticus, determines whether the vibrio parahemolyticus exists in the specimen or not.

The invention discloses a fourteen-food-borne pathogenic bacterium multiplex PCR detection primer set and a kit. The detection primer set is composed of primer pairs for detecting salmonella, Shigella, Vibrio parahemolyticus, campylobacter jejuni, campylobacter coli, staphylococcus aureus, bacillus cereus, Listeria monocytogenes, yersinia enterocolitica, enterobacter sakazakii, Escherichia coli, vibrio cholerae, Escherichia coli O157, aeromonas hydrophila and internal positive control. A multiplex PCR detection method based on an ordinary PCR platform is built, multiplex PCR reactions are carried out on genomic DNA, extracted from a sample to be tested, of bacteria in the same reaction system through the primer pairs acquired through analysis and design, and whether the food-borne pathogenic bacteria are contained in the sample or not is judged through the electrophoretic analysis of reaction products.

The invention provides a multiplex quantitative PCR (polymerase chain reaction detection kit for vibrio parahaemolyticus toxin gene and a detection method. The kit mainly comprises specific primers, probes and PCR reaction reagent, wherein the specific primers and the probes consist of specific primers and probes of vibrio parahaemolyticus thermostable direct hemolysin gene (tdh), thermolabile hemomysin gene (tlh), toxin expression regulating protein gene (toxR) and thermostable related hemolysin gene (trh). The invention provides the quick, sensitive and specific multiplex fluorescent quantitative PCR detection kit and the detection method aiming at the vibrio parahaemolyticus toxin gene, and provides basis for controlling food poisoning caused by the vibrio parahaemolyticus in time and early diagnosis of the food poisoning caused by the vibrio parahaemolyticus.

The invention relates to a Vibrio bacteriophage and a bactericidal composition preparation method and application thereof, belonging to the field of biotechnology. The bacteriophage composition comprises Vibrio alginolyticus bacteriophage vB_ValS_PcR-1 (accession number being CCTCC NO: M 2018391), Vibrio harveyi vB_VhaM_PcB-1G (accession number being CCTCC NO: M 2018392) and Vibrio parahaemolyticus phage vB_VhaP_OW (accession number being CCTCC NO: M 2015577). A high-potency culture product can be obtained after host actions, the composition is good in stability at room temperature, has a widehost splitting range, can efficiently inhibit growth of main pathogenic vibrios such as vibrio alginolyticus, vibrio harveyi, vibrio parahaemolyticus, can be applied as a biological antimicrobial agent for vibrio contamination control in food and aquaculture.

The invention discloses a loop-mediated isothermal amplification (LAMP) kit for rapidly detecting vibrio parahaemolyticus. The LAMP kit is composed of LAMP reaction liquid, a standard positive template and a negative quality control standard substance. The LAMP reaction liquid contains a Bst DNA polymerase big fragment, a primer, LAMP10*buffer, dNTPs solution, MgSO4 solution and glycine betaine. The primer is divided into a forward primer and a reverse primer. The LAMP kit has the advantages of being good in specificity, high in sensitivity, rapid and convenient, high in repeatability, capable of judging results by using eyes and the like, can conduct rapid qualitative detection on vibrio parahaemolyticus in industrial foods, and can replace continuously-used traditional culture method and serological diagnosis method.

The invention discloses a bacteriophage for preventing and treating a prawn vibrio parahaemolyticus disease and an expanding culture method thereof. Vibrio parahaemolyticus infected by South American white prawn are used for successfully screening out a strong lytic bacteriophage in seawater, titer of the bacteriophage is up to 1010 to 1012pfu / mL, fermentation period is 8 to 12h, treatment effects are obvious, and the bacteriophage for preventing and treating the prawn vibrio parahaemolyticus disease is of great significance for treatment of diseases causes by the vibrio parahaemolyticus and development of bacteriophage microecological preparations. A storage unit code of the bacteriophage is China Center for Type Culture Collection, address is China Center for Type Culture Collection in Wuhan University Campus, Wuchang Luojia Mountain, Wuhan City, preserved date is December 9, 2016, preservation number is CCTCC NO: M 2016740, a preservation test result is survival, name is vibrio parahaemolyticus bacteriophage VP11, and classification is named as Vibrio parahaemolyticus bacteriophage VP11.

The present invention relates to a method to detect bibrio parahemolyticus belonging to the technical field of biology, which is characterized in that: DNA template is prepared by centrifugating pure bacterial culture, discarding supernatant fluid, adding 100MuL sterile water for water bathing, ice bathing, centrifugation, removal of supernatant fluid as standby for expansion of the template. In addition, the method adopts primer 5.0 software to design four primer sequences of LAMP primer for bibrio parahemolyticus tlh gene M36437. Besides, loop-mediated isothermal amplification of bibrio parahemolyticus is applied. In detail, it is necessary to prepare a 25uL reaction system and carry out incubation and inactivation. Outcome detection refers to that turbidity of the reaction system is observed with naked eyes. Compared with prior arts, the detecting method of the present invention has the advantages of convenience, reliability, high sensitivity, short time and lower cost as a simple conventional detecting method, particularly adapts to grass-roots inspection and quarantine authorities and breed aquatics and brings great significance to improve food sanitation and boost development of international food trade.

The present invention discloses bacillus amyloliquefaciens and application thereof in aquaculture. The bacillus amyloliquefaciens SIP0902 strain is preserved in the China Center For Type Culture Collection (CCTCC), AND the preservation number is CCTCC NO:M2014323. The bacillus amyloliquefaciens is separated from intestinal tract of penaeus vanmamei, is an endogenous strain, and has strong antagonism to vibrio parahaemolyticus, vibrio anguillarum, vibrio alginolyticus and other 7 kinds of aquatic animal pathogenic vibrios. Bacillus amyloliquefaciens powder prepared from the bacillus amyloliquefaciens can significantly enhance non-characteristic immune function of the penaeus vanmamei, and can improve the pathogen infection resisting ability of prawn.

The invention relates to a quick, sensitive and high-throughput intestines source pathogenic bacterium detection method. The detection method provided by the invention integrates two powerful molecular biological techniques: polymerase chain reaction PCR and a micro-array, and directly fixes a probe of PCR hybridization in a hybridization cabin of the micro-array on a same chip with a PCR reaction chamber. The detection method comprises the following steps of enriching bacteria; extracting a DNA solution; carrying out PCR amplification; hybridizing; cleaning; and judging the result. The method provided by the invention can quickly detect genes of vibrio parahaemolyticus, Shigella, staphylococcus aureus, listeria monocytogenes and salmonella in high throughput, and the detection efficiency of front-line inspection and quarantine personnel of import and export ports can be greatly improved, thereby not only reducing the workload, but also solving the undetected positive result problem probably caused by conventional detection method to the maximum extent. Therefore, food safety incidents are prevented to the maximum extent.

The invention discloses an oligonucleotide primer for detecting common pathogenic bacteria by adopting a fluorescent quantitation PCR (Rich Client Platform) technology, a method thereof for detecting common pathogenic bacteria and the application thereof. The method comprises the following steps of: providing 10 pairs of specific oligonucleotide primer sequences at annealing temperature of 50-60 DEG C without differing 5 DEG C; and simultaneously, quickly, accurately and effectively identifying and quantificationally detecting various pathogenic bacteria at the same time. A detection range comprises bacillus cereus, enterobacter sakazakii, vibrio parahaemolyticus, enterohemorrhagic escherichia coli O157, salmonella, Listeria monocytogenes, Shigella, campylobacter jejuni, pseudomonas aeruginosa, klebsiella pneumoniae, and the like. The invention also can be used for the fields of disease diagnosis, environmental monitoring, water-quality and food supervision and detection, food poisoning pathogenicbacteria detection, bacteriological classification, epidemiological investigation, biological agent detection, and the like, is convenient, quick, accurate and effective and has wide application range.

The present invention relates to a detection chip for performing gene detection to various vibrio and its detection and applications. The invention provides 16S rRNA sequences corresponding to each vibrio of vibrio anguillarum, vibrio harveyi, vibrio alginolyticus, vibrio parahaemolyticus, brilliant vibrio and Fisher vibrio; heat shock protein hsp60 probe sequence; virulence gene probe sequence; 16S rRNA forward primer sequence; 16S rRNA reverse primer sequence; heat shock protein hsp60 forward primer sequence; heat shock protein hsp60 reverse primer sequence; virulence gene forward primer sequence and virulence gene reverse primer sequence. The present invention has specific, sensitive and high-throughput features, can simultaneously detect six kinds of bacteria virulence genes, and the invention will effectively guide the production as an important disease early-warning detection method used in clinical diagnosis of aquatic animals.

The present invention provides a gene chip for quickly detecting pathogens from food source, discloses the preparation method of said gene chip and provides 26 oligonucleotide probe sequences for detection. Said gene chip can quickly, accurately and high-effectively detect and identify the class of the pathogens in food, and its detection range includes staphylococcus aureus, Shiga's bacillus, salmonella, colibacillus 0157, bacillus proteus, mononuclear hyperplastic listerella, enterocolitis yersinia, aeruginous pseudomonads, vibrio parahaemolyticus, vibrio cholerae, bacillus cereus, beta hemolytic streptococcus, coconut fermentation pseudomonads, boticin, vibrio jejuni and bacillus perfringens, etc.

The invention relates to a multiplex PCR based primer pair and kit for detecting intestinal pathogens, particularly relates to a multiplex PCR based primer pair and kit for detecting 14 intestinal pathogens, and belongs to the technical field of PCR application. The 14 intestinal pathogens comprise vibrio cholerae (group O1 phage, group O139 phage and group non-O1 / O139 phage), listeria monocytogenes, enteropathogenic escherichia coli (EPEC), enterohemorrhagic escherichia coli (EHEC), enterotoxigenic escherichia coli (ETEC), enteroinvasive escherichia coli (EIEC), enteroaggregative escherichia coli (EAEC), shigella, intestinal virus EV71, enterohemorrhagic escherichia coli O157:H7, clostridium difficile, vibrio parahaemolyticus, salmonella enteritidis and salmonella typhimurium. The multiplex PCR based primer pair and kit can change the situation that only a few intestinal pathogens can be detected in one time and can be used for detecting 14 intestinal pathogens and 26 genes simultaneously.

The invention discloses a vibrio parahaemolyticus flagellin monoclonal antibody and an antigen capture ELISA (enzyme-linked immunosorbent assay) kit. The vibrio parahaemolyticus flagellin monoclonal antibody is produced by secreting of a hybridoma cell strain with the preservation number of CGMCC (China General Microbiological Culture Collection) No.6061. The vibrio parahaemolyticus flagellin monoclonal antibody can be used for detecting vibrio parahaemolyticus. The invention also discloses a vibrio parahaemolyticus flagellin capture ELISA (enzyme-linked immunosorbent assay) kit.

The invention discloses anti-vibrio parahaemolyticus chicken egg yolk antibody and the preparation method. The anti-vibrio parahaemolyticus chicken egg yolk antibody is prepared and obtained through the steps of preparation and inactivation of vibrio parahaemolyticus antigen, immunization of hens, collection of immunized eggs, coarse extraction of anti-vibrio parahaemolyticus chicken egg yolk antibody from the egg yolk liquid of the immunized eggs and purification. The invention also provides the application of the anti-vibrio parahaemolyticus chicken egg yolk antibody in food safety detection reagents and disease immune diagnostic reagents related with the preparation of vibrio parahaemolyticus and medicines and healthy products or feed additives for preventing and curing the related diseases of vibrio parahaemolyticus. The anti-vibrio parahaemolyticus chicken egg yolk antibody (IgY) prepared and provided by the invention has the advantages that the specificity and the purity are high, the anti-vibrio parahaemolyticus chicken egg yolk antibody has good effects when being used for preparing immunology testing reagents and medicines and feed additives for treating the related diseases of vibrio parahaemolyticus, the cost is low, the production volume is high, and the anti-vibrio parahaemolyticus chicken egg yolk antibody is easy to be industrialized.

The invention discloses a vibrio parahemolyticus dual-real-time fluorescence PCR (Polymerase Chain Reaction) detecting primer, a probe, a detecting kit and a detecting method. The primer, the probe and the reaction condition are optimized and designed by using a dual-real-time fluorescence PCR method and adopting a toxR gene and a tdh gene of vibrio parahemolyticus as target genes, so that the toxic gene is detected when specific detection is carried out on the vibrio parahemolyticus in an amplification reaction, the toxR gene is used for specifically detecting the vibrio parahemolyticus, andthe tdh gene is used for detecting whether a toxic gene is carried or not. The invention has the advantages of rapid detection, reliable result, high sensitivity and high specificity, can finish the process from sample preparation to detecting result issuing in 8 to 10 hours, is free from the inference of false positive gender, cross contamination, and the like, provides a favorable tool for carrying out epidemiological survey of vibrio parahemolyticus, is suitable for inspection and quarantine of foods and marine products and can enable an inspection and quarantine bureau, a disease prevention and control center and a quality supervision department to carry out simple, rapid and accurate detection on the sample.

The invention discloses a gene chip of aquatic product cultivation pathogenic bacterium, comprising a solid phase carrier which is modified chemically, a detection probe and a quality control probe are distributed on the solid phase carrier in a dot matrix way; the detection probe comprises specificity 16S rDNA sequences and / or gyrB gene sequences of vibrio, comma bacillus, vibrio harveyi, vibrio alginolyicus, vibrio anguillarum, vibrio parahemolyticus, nocardia, nacardia seriolea, aeromonas, hydrophilic aeromonas, streptococcus and dolphin streptococcus, which are to be detected, the quality control probe includes PCR positive, chip fixed positive control, chip hybridizing negative control, chip hybridizing positive control and chip hybridizing blank control; the gene chip has the advantages of small volume and high flux, can detect known and unknown germs of the vibrio, the nocardia, the aeromonas and the streptococcus, and can detect specific germs with multiple kinds, and the simpleness and rapidness and specificity of the germs can be detected, and automatic detection can be carried out after detection software is additionally arranged.

The invention provides a gene chip of main pathogenic microorganism in drinking water and a testing kit, which mainly aims at 11 kinds of bacteria of colibacillus / Shigella, salmonella, vibrio cholera, vibrio parahaemolyticus, staphylococcus aureus, enterococcus faecails, pseudomonas aeruginosa, legionella pneumophilia, pneumobacillus, yersinia enterocolitica and the like, and L.interrogans. The gene chip comprises a solid phase carrier and a oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe contains gyrB gene with tremendous evolutionary advantage, ITS gene and DNA segment selected from 16srRNA gene or complementary DNA segment. The gene chip and the testing kit of the invention can test the main pathogenic microorganism in drinking water, and has the characteristics of simple operation, high throughput, high accuracy, strong repeatability and the like, and can be used for clinical test for the water quality monitoring department.

The invention relates to a complex enrichment medium used for salmonella, vibrio parahaemolyticus and comma bacillus and a method for preparing the same. The formulation components of the complex enrichment medium in weight portion are as follows: 0.5 to 1.5 portions of buffer peptone water, 1000 portions of distilled water, 1.0 to 5.0 portions of glucose, 1.0 to 5.0 portions of mannitol, 0.03 to 0.06 portion sodium pyruvate, 0.5 to 2.5 portions of anhydrous sodium sulfite, 1.0 to 10.0 portions of sodium citrate, 5.0 to 25.0 portions of sodium chloride, 1 to 5 portions of cholate, and 0.0005 to 0.0025 portion of potassium tellurite. The method comprises the following steps: firstly, adding the buffer peptone water and the like into the distilled water, and sterilizing the mixture after heating and melting; and secondly, cooling the mixture to 50 DEG C, and then adding the potassium tellurite into the mixture to be mixed evenly. The complex enrichment medium can integrate two steps of primary enrichment and selective enrichment of bacterial detection to shorten the enrichment time to 24 hours, can perform enrichment on three target pathogens at the same time, and can inhibit the growth of other microorganisms.

The invention discloses a vibrio parahaemolyticus phage VP-HYP2 and application of the vibrio parahaemolyticus phage VP-HYP2 in prevention and control over pathogenic vibrio parahaemolyticus infectionof whiteleg shrimps, and belongs to the field of biotechnology. According to the vibrio parahaemolyticus phage VP-HYP2 and the application of the vibrio parahaemolyticus phage VP-HYP2, a double-layeragar plate method is utilized for separating a bacteriophage strain named the vibrio parahaemolyticus phage VP-HYP2 from wastewater generated from breeding of the whiteleg shrimps in Taizhou, and thepreservation number is CCTCCNO:M2019227. The provided vibrio parahaemolyticus phage VP-HYP2 is wide in pH tolerance range and high in thermostability, after the vibrio parahaemolyticus phage VP-HYP2is used for treating pathogenic vibrio parahaemolyticus causing acute hepatopancreatic necrosis of the shrimps, the number of bacteria is significantly reduced in a short time, and therefore the provided vibrio parahaemolyticus phage VP-HYP2 has a good application prospect in prevention and control over the pathogenic vibrio parahaemolyticus causing acute hepatopancreatic necrosis of the shrimps.

The invention discloses a microbial preparation, an aquatic feed and an aquaculture method and relates to the technical field of aquaculture. The microbial preparation comprises bdellovibrio and probiotic. Optimally, the probiotic is selected from any one of lactobacillus bulgaricus, lactobacillus delbrueckii, enterococcus faecalis, lactobacillus casei, lactobacillus acidophilus, rhodopseudomonaspalustris, clostridium butyricum, bacillus laterosporus, bacillus pumilus, bacillus coagulans, bacillus licheniformis, bacillus subtilis and lactobacillus plantarum. The microbial preparation has thecharacteristics of capability of increasing food intake of aquaculture animals, capability of promoting growth rate, survival rate and immunity of organisms, and the like. Besides, the microbial preparation is capable of effectively preventing and treating the problems of diseases caused by pathogenic bacteria, such as vibrio parahaemolyticus, vibrio harveyi, luminous vibrio, vibrio alginolyticus,vibrio campbellii, vibrio fluvialis, vibrio vulnificus, aeromonas, vibrio cholerae, pseudomonas and salmonella.

The invention relates to the technical field of microbes, and provides a novel vibrio parahaemolyticus phage as well as a composition, a preparation method and application thereof. The novel vibrio parahaemolyticus phage specifically refers to a vibrio parahaemolyticus phage VP46 of which the collection number is CCTCC NO:M2016290, a vibrio parahaemolyticus phage VP48 of which the collection number is CCTCC NO:M2016291 or a vibrio parahaemolyticus phage VP7 of which the collection number is CCTCC NO:M2016289. The phage is a strictly virulent phage, is highly toxic to host bacteria, has a widerhost range, and is highly toxic to the host bacteria at a low concentration; DNA (Deoxyribonucleic Acid) of the phage cannot encode proteins which may cause a potential health risk; the phage survives stably in a culture solution at room temperature, and survives for more than 12 months at a temperature of below 4 DEG C; the phage can be well proliferated on a non-pathogenic bacterial host; and large-scale industrial production can be realized.

The invention discloses a vibrio parahaemolyticus detection method based on a graphene oxide / ferroferric oxide / colloidal gold composite nanoparticle enhanced Raman effect. A graphene oxide / ferroferric oxide / colloidal gold (GO / Fe3O4@Au) composite nanoparticle is used as an active enhanced base, and a sulfhydrylization modified vibrio parahaemolyticus aptamer is added into the prepared GO / Fe3O4@Au composite nanoparticle, so that the vibrio parahaemolyticus aptamer is fixed on the base. A detected matter is mixed with the GO / Fe3O4@Au composite nanoparticle modified by the vibrio parahaemolyticus aptamer, and then the other vibrio parahaemolyticus aptamer modified by a Raman signal TAMRA is used for hatching; and Raman spectrum detection is carried out. By specifically combining the aptamer with vibrio parahaemolyticus, the detection of the vibrio parahaemolyticus in foods is realized. The method is high in sensitivity, high in specificity and convenient to operate, and has a wide application prospect in the field of food safety detection.

The invention relates to a microorganism detection device and a method for detecting. A multiple PCR rapid detection reagent kit for pathogenic bacteria in aquatic products is characterized in that the kit comprises 10*PCR buffer, 1.0-3.0mmol / L MgC1 2, 240 mu mol / L dNTP each, 60-200nmol / L salmonella primers, 60-200l / Lvibrio parahaemolyticus primers, 200nmol / L Listeria monocytogenes primers and 1.3-3.0 U Taq enzyme. The method has comparatively good specificity, simultaneous detection for salmonella, vibrio parahaemolyticus and Listeria monocytogenes in the water products can be realized conveniently, rapidly, and sensitively, the detection limit for artificially contaminated water products is 10cfu / mL, and the method provides ideal methods for rapidly detecting food-borne pathogenic bacteria of non-polluted water products and is provided with good application prospect.

The invention discloses a composite enrichment medium for salmonella, staphylococcus aureus, escherichia coli, listeria monocytogenes and vibrio parahaemolyticus and a preparation method for the composite enrichment medium. The composite enrichment medium comprises the following components in parts by weight: 5-10 parts of ox brain extract powder, 5-15 parts of ox heart extract powder, 5-15 parts of peptones, 2.5-7.5 parts of sodium chloride, 1-3 parts of glucose, 1.5-3.5 parts of disodium hydrogen phosphate, 1-3 parts of mannitol, 1-3 parts of sodium pyruvate, 1-3 parts of glycine, 1-3 parts of aesculin, and 1000 parts of distilled water, and a pH value of the composite enrichment medium is 7.2-7.5. A preparation method for the composite enrichment medium comprises the following steps: adding the components into distilled water according to the formula, stirring and dissolving the components, regulating the pH value of the mixture, and sterilizing the mixture at high pressure. The five bacteria are main pathogenic bacteria which are needed to be detected according to the national food hygienic standard. The composite enrichment medium can be used for realizing rapid proliferation of the five pathogenic bacteria. After carrying out bacteria enrichment for 16 hours, the concentration of the thallus can be increased to 10<6>CFU / mL-10<9>CFU / mL from 1CFU / mL, so that the thallus can be directly used for carrying out high flux detection on multiple PCRs (polymerase chain reactions), gene chips and micro-fluidic chips, and thus, screening of the five pathogenic bacteria is completed.

The invention relates to a gene chip and an application, which belongs to the biological detection field. The invention designs a set of detection probes by aiming at 11 types of common infectious diarrheal disease pathogen microorganism in clinic, and the gene chip containing the set of the probe. The detection probes comprises a vibrio parahaemolyticus probe, a vibrio vulnificus, a vibrio cholera probe, a vibrio alginolyticus probe, a vibrio furnissii probe, a shigella probe, an escherichia coli probe, an aeromonas probe, a salmonella probe, a campylobacteria probe, and a proteusbacillus vulgaris probe; the above mentioned probe sequence is shown as SEQ ID No: 1-117. The gene chip and probe can detect 11 types of common infectious diarrheal disease pathogen, the detection flux is high, the specialty is strong, the sensitivity is high, and the detection is rapid and effective.