Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit and method for detecting Bibrio Parahemolyticus using loop-mediated equal-temperature amplification technology

A ring-mediated isothermal and hemolytic vibrio technology, which is applied in the direction of resistance to vector-borne diseases, biochemical equipment and methods, and microbial measurement/inspection, can solve the problems of cumbersome operations, time-consuming, and inability to meet disease control, and achieve High sensitivity and strong specificity

Inactive Publication Date: 2007-08-01
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 39 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In the past, there were mainly three ways to detect Vibrio parahaemolyticus: 1. biochemical identification method, which was time-consuming and complicated to operate, and could not meet the needs of disease prevention and control; 2. enzyme-linked immunosorbent assay (ELISA method), which had high sensitivity, Features such as fast detection, can be used for the detection of a large number of specimens, but the false positive problem that occurs when testing fresh samples also limits the wide application of this method to a certain extent; 3. Polymerase chain reaction (PCR method), This method is faster and more sensitive than the previous two methods, but requires an expensive PCR machine
There are no reports on kits and methods for detection of Vibrio parahaemolyticus using loop-mediated isothermal amplification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The following examples are further illustrations of the present invention and should not be regarded as limiting the present invention.

[0033] Make the loop-mediated isothermal amplification detection kit for Vibrio parahaemolyticus according to the following formula:

[0034] (1) LAMP reaction solution A:

[0035] 2.5uL 10×Thermopol reaction buffer, 1.0uL 10mM dNTP (mixture of four deoxynucleotides), 1.0uL 20uM upstream internal primer (para-FIP), 1.0uL 20uM downstream internal primer (para-BIP), 0.25uL 20uM upstream outer primer (para-F3), 0.25uL 20uM downstream outer primer (para-B3), 0.5uL 100mM MgSO 4 , 12.5uL 2M betaine and 4uL ddH 2 O (sterilized double distilled water).

[0036] (2) Bst DNA polymerase B: the concentration is 8 U / uL.

[0037] (3) Developer C: 10% SYBR GREEN I.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit checking vibrio parahaemolyticus with mediated isothermal amplification technology and the method. Said kit comprises LAMP reacting liquid A, downstream inner primer DNA polymerase B and coloured solution; and the upstream inner primer in LAMP reacting liquid A is tctggtcagcaagcagcagttttttcgccgaccacatttctca; downstream inner primer is acccgtactatccaactgcgcttttggcgcgtacttagcaagg; upstream outer primer is ccaagcgtttcgtcacca; downstream outer primer is caaagctttgtgcgaactcg. The checking method comprises extracting bacteria DNA, mediated isothermal amplification for vibrio parahaemolyticus, and coloring detection. The invention is characterized by fast speed, strong specificity, high sensitivity and low cost.

Description

technical field [0001] The invention relates to a kit for detecting Vibrio parahaemolyticus by using a loop-mediated isothermal amplification method, and further relates to a method for rapidly detecting Vibrio parahaemolyticus using the kit. Background technique [0002] Vibrio parahaemolyticus (VP ​​for short) is a halophilic Gram-negative pathogen widely distributed in oceans and saline lakes. This bacterium is one of the main pathogens causing food-borne diseases. Due to the consumption of seafood contaminated by Vibrio parahaemolyticus and not well processed, it can cause intestinal diseases such as diarrhea and food poisoning in humans, and even cause sepsis. Its pathogenicity is second only to Vibrio cholerae, and it is an important object for microbial inspection of imported and exported aquatic products. The bacteria can cause septicemia in fish, shrimp, shellfish, etc., red leg disease and gill rot in cultured prawns, which bring serious economic losses to the aqu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04G01N21/25
CPCY02A50/30
Inventor 任春华胡超群罗鹏王青柏
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More