Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

48 results about "Larynx carcinoma" patented technology

Tumor correlated albumen, coding gene and application thereof

The present invention discloses a tumour-related protein and its coding gene. The tumour-related protein is as follows: (a) a protein composed of sequence 4 amino acid residue in sequence list; (b) a protein derived from (a) by substituting and / or deleting and / or adding one or several amino acid residue of sequence 4 amino acid residue in sequence list The recombinant mammal gene expression vector containing tumour-related protein coding gene can be used as antineoplastic drug for preventing and / or treating lung cancer, esophageal carcinoma or cancer of larynx.
Owner:CANCER INST & HOSPITAL CHINESE ACADEMY OF MEDICAL SCI +1

Preparation of hemsleyadine-A and its use of preparing pharmaceutics against cancers

Production of medicinal component snow bile pigment and its usage for preparing medicines in treatment of cancers are disclosed. The process is carried out by taking snow bile plant tuber, crushing, taking acetone 18-26 proportion as solvent, extracting by diacolation method, recovering extract in water-bath kettle at 60-75 degree to obtain extractive, adding extractive into silica gel 1-2 proportion, drying to obtain silica-gel column, gradient eluting by ethanol or chloroform with volume concentration 2-10%, recovering eluent to obtain coarse product, heating while dissolving for ethanol or alcohol in water bath, filtering, lowering to room temperature, re-crystallizing to obtain prism crystal with purity above 98%. It can be used to prepare medicines in treatment of hepatocarcinoma, lung cancer, gastric carcinoma, laryngeal cancer and leukemia.
Owner:KUNMING LONGJIN PHARMA

Photosensitizers and MRI enhancers

The present invention relates to the use of a compound of formula 3 or a salt thereof to prepare a medicament or phototherapeutic agent for treating the following diseases, including: acne; AIDS; viral hepatitis; diabetic retinopathy; SARS virus infection; coronavirus Arterial stenosis; carotid artery stenosis; intermittent claudication; Asian (chicken) avian influenza virus infection; cervical dysplasia or various cancers, including: blood cancer, cervical cancer, nasopharyngeal cancer, tracheal cancer, laryngeal cancer, bronchial cancer , bronchiolar cancer, bladder cancer, esophageal cancer, stomach cancer, rectal cancer, colon cancer, prostate cancer, hollow organ cancer, bile duct cancer, urinary tract cancer, kidney cancer, uterine cancer, vaginal cancer and other gynecological adnexal cancer. The present invention also relates to methods of treating the above diseases. The present invention further relates to the use of the compound of formula 3 or a salt thereof to prepare a photodiagnostic agent for detecting the above-mentioned diseases and the following diseases, including: atherosclerosis, multiple sclerosis, diabetes, arthritis, rheumatism Arthritis, fungal infections, viral infections, chlamydial infections, bacterial infections, or parasitic diseases, HIV viral infections, hepatitis, herpes simplex, shingles, psoriasis, cardiovascular disease, and skin diseases. The present invention also relates to methods for detecting the above diseases using photodiagnostic agents. The present invention further relates to a method for low-temperature sterilization of surgical devices or other devices, including the steps of: providing a compound of Chemical Formula 3 or a salt thereof on the device; and subjecting the device to radiation treatment or sonication treatment. The invention further relates to a compound of formula 3 or a salt thereof linked or attached to a magnetic element. This compound acts as an MRI enhancer. The invention also relates to the use of such MRI enhancers for performing MRI scans.
Owner:PHOTO DIAGNOSTIC DEVICES PDD

Application of recombinant ganoderma lucidum immunomodulatory protein rLZ-8 in treating lung cancer, laryngocarcinoma and brain glioma

The invention relates to an application of recombinant ganoderma lucidum immunomodulatory protein rLZ-8 in treating lung cancer, laryngocarcinoma and brain glioma. According to the invention, the in-vivo anti-tumor effect of the rLZ-8 is researched by respectively building a lung cancer mice model by virtue of a caudal vein injection method and building a laryngocarcinoma and brain glioma nude mice animal model by virtue of a subcutaneous transplantation tumor method; a treatment result indicates that the rLZ-8 achieves an obvious anti-tumor effect on the lung cancer, the laryngocarcinoma and the brain glioma.
Owner:张喜田 +1

Transoral surgical devices and methods

Devices and methods can be used for performing transoral surgery. For example, this document provides oral retractor devices and articulating surgical tools that are well-suited for transoral surgery uses. The devices and methods provided herein may be used to treat conditions such as, but not limited to, mouth cancer, throat cancer, tongue cancer, larynx cancer, tonsil cancer, obstructive sleep disorders, and pharyngeal diverticulum, to provide some examples.
Owner:MAYO FOUND FOR MEDICAL EDUCATION & RES

Mussel adhesive protein product and use thereof for treating mucosal inflammation

The invention relates to a mussel adhesive protein (MAP) and an application thereof in inhibiting catarrh, and specifically, to applications of a MAP or a product thereof in oral mucositis, rhinitis, otitis media, pharyngitis, laryngitis, bronchitis, esophagitis, gastritis, enteritis, cervicitis, endomyometritis, inflammation resulting from inhalation injury, and oral cavity cancer, nasopharyngeal cancer, carcinoma of middle ear, conjunctival cancer, laryngeal cancer, lung cancer, esophageal cancer, stomach cancer, bowel cancer, cervical cancer, endometrial cancer, and other cancers resulting from the inflammation. The MAP can inhibit symptoms such as flush, fever, swell, and pain owing to catarrh, facilitating healing, relieving itch and pain, and having broad applications in the fields of medicines, cosmetics, medical products, disinfection products, healthcare products, foods, and household goods.
Owner:BENGT I SAMUELSSON INST OF LIFE SCI CO LTD

Naphthaquinone compound derived from marine microbes, and preparation method and application thereof

The invention discloses a naphthaquinone compound derived from marine microbes, and a preparation method and application thereof. The systematic name of the compound is 1,2,3,4-tetrahydro-1,2,5-trihydroxy-6,7-dimethoxy-3-methyl-9,10-anthracenone, and the structure is disclosed as Formula (I). The naphthaquinone compound can be continuously obtained by fermentation. The compound has the advantages of high antineoplastic activity, environment friendliness and low use cost, and can be used for preparing antineoplastic drugs. The active naphthaquinone compound derived from microbes is small in amount and simple in structure, and can be used as a precursor of antineoplastic drugs; the structural modification and reconstruction on the basis of the prior art enhance the antineoplastic targeting property and efficiency; and when being used for developing drugs for treating human stomach cancer, human lung cancer, mouse melanoma, human mammary cancer, human pancreatic cancer, human cervical carcinoma, human osteogenic sarcoma, human liver cancer, human colon cancer and human laryngocarcinoma, the naphthaquinone compound has wide application prospects.
Owner:大丰海洋生物医药研究所 +3

Traditional Chinese medicine preparation for main treatment of esophagus cancer and preparation method and application thereof

The invention provides a traditional Chinese medicine preparation and for main treatment of esophagus cancer and a preparation method thereof, and the traditional Chinese medicine preparation is prepared by selection of pearl, ginseng, calculus bovis, bear gall, borneol, stiff silkworm, house lizard, centipede, pseudo-ginseng, menthol, cinnabar, borax, smoked plum, propolis, tendril-leaved fritillary bulb, ephedra, pinellia tuber, scutellaria barbata and other medicinal materials. The traditional Chinese medicine preparation has the main effects of downbearing counterflow and checking vomiting, eliminating phlegm and detoxifying, softening hardness and dissipating stasis, transforming putridity and promoting tissue regeneration, dredging esophagus, relieving pain, and suppressing and resisting cancer. The traditional Chinese medicine preparation has good effects on esophageal discomfort, dysphagia, esophageal stenosis and obstruction caused by early and middle-late esophageal cancer, can kill cancer cells and inhibit the growth of the cancer cells, prevents the spread of the cancer cells, improves microcirculation, can be used for spasmolysis of smooth muscle so as to inhibit cancer cell growth and metastasis, is mainly used for esophageal cancer, also has certain curative effect on cardiac cancer, gastric cancer, ingluveosis phrenospasm, laryngeal cancer, lung cancer, liver cancer, breast cancer, pancreatic cancer, cervical cancer, intestinal cancer, esophagitis, various kinds of pharyngolaryngitis and the like.
Owner:刘洪 +1

Laryngocarcinoma total-nutrient formula food

The invention provides a total-nutrient formula food for laryngocarcinoma patients, a specific total-nutrient formula food or a non-total-nutrient formula food. The formula food is prepared by crushing and mixing a plurality of types of medicinal and edible Chinese medicine extract essences, a plurality of types of micro-encapsulated probiotic bacteria, short peptide, prebiotics, amino acid, carbohydrate, a plurality of types of vitamins and minerals together by combining physical characteristics of laryngocarcinoma patients according to requirements of 'General Principles for Special Medical Formula Foods', wherein the plurality of types of the medicinal and edible Chinese medicine extract essences are extracted by virtue of a prehydrolysis SBE (Starch Branching Enzyme) technology, and the short peptide, prebiotics, amino acid, carbohydrate and vitamins are extracted by virtue of biological enzymolysis. The food not only can be used as a single nutrient source to meet nutritional requirements of the laryngocarcinoma patients, but also can achieve effects of clearing heat and eliminating phlegm, dispelling wind and relieving sore-throat, eliminating mass and relieving swelling, promoting blood circulation to dispel blood stasis, supplementing qi and nourishing yin, dissipating and discharging stagnated fire and strengthening immunity.
Owner:胡安然

ING4 and OSM double-gene co-expression vector and application thereof

The invention belongs to the field of adenovirus vectors and in particular discloses a recombinant adenovirus vector Ad-ING4-OSM and a preparation method thereof. The preparation method comprises the following steps: on the basis of a transfer plasmid pAdTrack-CWV-polyA-promoter, inserting an ING4 segment between BglII and SalI polyclonal sites of the transfer plasmid and inserting an OSM segment between NOtI and HindIII restriction sites of the transfer plasmid so as to prepare a recombinant transfer plasmid pAdTrack-CWV-ING4-poly-A-promoter-OSM; carrying out co-transformation on the recombinant transfer plasmid and a pAsEasy-1 adenovirus skeleton plasmid to BJ5183 competence bacteria with a calcium chloride method; screening, carrying out PacI restriction, and transfecting QBI-293A cells with a liposome; and carrying out multi-time infection and amplification so as to obtain the recombinant adenovirus vector Ad-ING4-OSM. Compared with the Ad-ING4 and Ad-OSM single genomes, the recombinant adenovirus vector Ad-ING4-OSM shows obvious tumor-inhibiting synergy and radiotherapy sensitizing synergistic effect on human laryngocarcinoma Hep-2 cells and nude mouse transplanted tumor thereof and shows superimposed anticancer synergy for inhibiting growth of SPC-A1 pulmonary adenocarcinoma cells and inducing apoptosis.
Owner:SUZHOU UNIV

Throat root-treating traditional Chinese medicine composition for treating throat diseases

InactiveCN113332378ARegulate Yin and Yang balanceEliminate cold, heat and humidityAntipyreticAnalgesicsMedicinal herbsDisease
The invention provides a throat root-treating traditional Chinese medicine composition for treating throat diseases, and relates to the field of traditional Chinese medicine compositions. The invention discloses the throat root-treating traditional Chinese medicine composition for treating throat diseases. The composition consists of the following raw materials in parts by weight: fennel, bulbus fritillariae cirrhosae, honey, sesame oil, Nanyang golden butterfly and fructus evodiae. In the application, according to the traditional Chinese medicine theory and the principle of five-element mutual generation of gold, wood, water, fire and soil, five medicinal materials are concentrated, properties and flavors of the five medicinal materials are matched, mutual generation of wood, fire, soil, gold and water in the traditional Chinese medicine theory is formed, yin and yang balance in the body is effectively regulated, cold, heat and humidity in the body are removed, acute and chronic throat diseases such as chronic pharyngitis, hoarseness, throat discomfort and the like are fundamentally treated, and the traditional Chinese medicine composition has auxiliary prevention and treatment effects on esophagus cancer, laryngeal carcinoma and the like.
Owner:郭建芳

Compound Tibetan medicine for treating rhinocarcinoma, laryngocarcinoma, nasosinusitis, toothache, suppuration and bleeding

The invention relates to a compound Tibetan medicine for treating rhinocarcinoma, laryngocarcinoma, nasosinusitis, toothache, suppuration and bleeding and a production method thereof. The compound Tibetan medicine preparation disclosed by the invention comprises the following raw materials: 1-50g of yulan magnolia flower fruits, 2-100g of goldthread root, 1-50g of bear gall, 1-50g of musk, 1-50g of calculus bovis, 10-200g of coriander seeds, 10-200g of lily and 10-300g of rosin powder.
Owner:设孜丹增群佩

Non-whole nutrient formula food for laryngocarcinoma

The present invention belongs to the technical field of medicinal and edible food formulas and new resource foods and specifically provides non-whole nutrient formula food, special whole nutrient formula food or whole nutrient formula food for patients with laryngocarcinoma to eat. According to the requirements of General Principles of Special Medical Use Formula Foods, in combination with the constitutive characters of the patients with laryngocarcinoma, and based on the essence of traditional Chinese medicine theory, a variety of medicinal and edible traditional Chinese medicines are reasonably combined; a plurality of types of traditional Chinese medicine extract essences which are extracted by a prehydrolysis SBE technology, oligopeptides extracted by biological enzymolysis, prebiotics, amino acids, carbohydrates, fats with healthcare functions, a plurality of types of vitamins and mineral substances are mixed and then treated by other processes, thereby obtaining the formula food. The formula food can be used as a single nutrient source to meet the nutritional requirements of the patients with laryngocarcinoma, and also has effects of clearing heat and eliminating phlegm, dispelling wind and relieving sore-throat, eliminating mass and relieving swelling, treating cough and asthma, removing phlegm and improving immunity.
Owner:JINSHANMEI BIOTECH

Medicine for treating laryngeal cancer and lung cancer

InactiveCN113082179ATreat qi and blood abdominal distensionRespiratory disorderAntineoplastic agentsDiseaseMyrrh
The invention discloses a medicine for treating laryngeal cancer and lung cancer. The medicine is prepared from the following raw materials by weight: 15g of vietnamese sophora root, 15g of divaricate saposhnikovia root, 15g of cape jasmine, 20g of almond, 15g of poria cocos, 15g of root of himalayan rhododendron, 15g of honeysuckle flower, 15g of dandelion, 30g of three-leaf clover, 15g of giant knotweed rhizome, 10g of frankincense, 10g of myrrh, 20g of clove, 20g of dahurian angelica root, 15g of pseudobulbus cremastrae seu pleiones, 15g of cynanchum glaucescens, 20g of tendril-leaved fritillary bulb, 20g of rhizoma cyperi, 20g of leech, 15g of scorpion, 10g of centipede, 15g of gecko, 20g of agilawood and 15g of radix stemonae. The medicine has been applied to a large number of patients to relieve or even eradicate the diseases; the preparation method is simple, and the required Chinese herbal medicines are mixed and decocted and are taken according to different diseases.
Owner:李松华

Application of tRF expression primer in detection tissue in preparation of laryngeal cancer auxiliary diagnosis kit

The invention relates to application of a tRF expression primer in detection tissue in preparation of a laryngeal cancer auxiliary diagnosis kit. The tRF expression primer is characterized in that the nucleotide sequence of tRF-33-Q1Q89P9L842205 is shown as SEQ ID NO: 1, and the specific expression of the tRF-33-Q1Q89P9L842205 in the tissues of laryngeal cancer patients is reduced: the primer is F1: 5'ATAAGCGCCGCTGGTGTAGTG3'; and R1: 5'TATGGTTGTTGACGACTGGTTGAC3'. Compared with the prior art, the tRF expression primer has the advantage that specific expression down-regulated tRF-33-Q1Q89P9L842205 in laryngeal cancer tissues can be used as a novel molecular marker for laryngeal cancer diagnosis.
Owner:NINGBO MEDICAL CENT LIHUILI HOSPITACL

Construction method of combined animal model of blood stasis, phlegm coagulation syndrome and laryngeal cancer syndrome

The invention discloses a method for constructing an animal model combining blood stasis and phlegm syndrome and laryngeal cancer syndrome, and belongs to the technical field of animal model construction. Animals with blood stasis and phlegm coagulation syndrome were constructed by combining subcutaneous injection of plain protein; laryngeal cancer cells were injected under the skin of the axilla of animals with blood stasis and phlegm coagulation syndrome, and the animals used were Balb / c nude mice. The construction method of the present invention uses multiple factors to combine blood stasis and phlegm coagulation syndrome with laryngeal cancer, and the verification indexes for successful construction include blood lipid function and coagulation time, and the animal model has high reliability and good repeatability.
Owner:GUANGDONG HOSPITAL OF TRADITIONAL CHINESE MEDICINE

Pharmaceutical composition for treating tongue cancer and laryngocarcinoma

The invention discloses a pharmaceutical composition for treating tongue cancer and laryngocarcinoma. The pharmaceutical composition is prepared from the following raw materials in parts by weight: 12-24 parts of cynanchum paniculatum, 12-24 parts of solanum lyratum, 12-24 parts of mock-strawberry, 12-24 parts of sapindus mukorossi gaertn root, 12-24 parts of Chinese actinidia root, 12-24 parts of pseudo-ginseng, 12-24 parts of ginseng, 12-24 parts of astragalus membranaceus, 12-24 parts of desert cistanche, 12-24 parts of nightshade, 12-24 parts of spina gleditsiae, 12-24 parts of indigo naturalis, 12-24 parts of air potato, 9-21parts of calculus bovis factitious, 9-21parts of subprostrate sophora, 9-21parts of calomel, 9-21parts of musk, 9-21parts of borneol, 9-21parts of salviae miltiorrhizae and 9-21parts of talcum powder, the raw materials are combined to active components, the pharmaceutical composition has a good curative effect on tongue cancer and laryngocarcinoma. The invention further discloses use of the pharmaceutical composition.
Owner:李绍华

Laryngeal precancerous lesion animal model and construction method and application thereof

ActiveCN112400801ATouch and attachProlong stimulation timeAnimal husbandryQuinolineCancer Causing Agents
The invention relates to a laryngeal precancerous lesion animal model and a construction method and application thereof. The construction method comprises the steps that a dichloromethane solution dissolved with 4-nitro quinoline-1-oxide is smeared on the laryngeal mucosa of an animal, and the laryngeal precancerous lesion animal model is obtained. 4NQO and dichloromethane are combined to achievea synergistic carcinogenic effect, so that the time required for successfully making the model by single drugs can be obviously shortened; the model is similar to a human patient, the laryngeal mucosaof the model turns white, spinous protrusions appear on the surface, or plaques and superficial ulcer appear on the surface of the laryngeal mucosa, and the model is highly similar to the patient inperformance and has good clinical symptom simulation; secondly, the 4NQO can be directly dissolved in the dichloromethane, so that the solubility and the stability of the 4NQO are improved; and a prepared mixed solution has certain viscosity and can be in better contact with and attached to the laryngeal mucosa when smeared on the laryngeal mucosa, and the stimulation time of cancerogen to the laryngeal mucosa is obviously prolonged. The construction method does not induce gastrointestinal tumors and reduces interference factors.
Owner:THE SECOND HOSPITAL OF TIANJIN MEDICAL UNIV

Traditional Chinese medicine preparation for treating rhinocarcinoma and laryngocarcinoma

The invention relates to a traditional Chinese medicine preparation for treating rhinocarcinoma and laryngocarcinoma. The traditional Chinese medicine preparation is characterized in that three traditional Chinese medicines including semen cuscutae, herba portulacae and whorled stonecrop are adopted as raw materials, and the semen cuscutae, the herba portulacae and the whorled stonecrop are takenin a weight ratio of raw materials being 5:5:5; and 5 g of the semen cuscutae, 5 g of the herba portulacae and 5 g of the whorled stonecrop are selected as the dose of one medicine and soaked in 250 gof boiling water for 11-12 h to prepare the traditional Chinese medicine preparation. The medicine is taken once before breakfast and after supper. The traditional Chinese medicine preparation for treating the rhinocarcinoma and the laryngocarcinoma is prepared according to a traditional secret prescription, can treat both symptoms and root causes by traditional Chinese medicine typing diagnosisand treatment based on overall analysis of illness and patient's conditions, has short treatment course, high treatment effects and low treatment cost and has no adverse reactions, toxic or side effects. Results of 1000 cases or more in clinical application prove that the total effective rate can reach 99% or above, the treatment effect is better, and relapse is avoided in a follow-up clinic period.
Owner:汪福海

Profiling chemically modified DNA/RNA units for disease and cancer diagnosis

The present invention relates to high-throughput methods comprising direct infusion electrospray ionization mass spectrometry (ESI-MS), multistep tandem mass spectrometry (MSn), consecutive reaction monitoring (CRM), ion mobility spectrometry mass spectrometry (IMS-MS), high-resolution MS, and IMS-MS, for genome-wide (whole cell or tissue) profiling of DNA and RNA nucleotides / nucleosides having a wide variety of variant structural modifications. In particular, these methods are contemplated for providing a specific profile of variant DNA and / or RNA chemically modified nucleic acids (i.e. structures) associated with specific medical conditions. Medical conditions may include, but are not limited to: cancer; including prostate, lung, uterus, larynx, ovary, breast, kidney, and many other types of cancers; specific stages of cancer; bacterial infections; viral infections; genetic and metabolic disorders; and any condition involving changes in DNA and / or RNA structural modifications.
Owner:THE RES FOUND OF STATE UNIV OF NEW YORK

Synthesis of quercetin platinum

The invention relates to quercetin which has multiple aspects of biological activities, and has effects of phlegm elimination, asthma relief and antiatheroscloresis, etc., and has activities of fighting against the hyperplasia of various tumor cells; platinum complexes have obvious anticancer effect and the combination use of the quercetin and the cisplatin results in synergistic effects. In the invention, the quercetin reacts with a platinum compound under a certain condition for obtaining a quercetin platinum complex by being subjected to reversion, distill, chromatography and separation. The results from the MIT method experiment show that the quercetin platinum significantly inhibits the cell proliferation of tumors such as hepatoma HepG2, cervical carcinoma Hela and laryngocarcinoma Hep2, etc.
Owner:ZHENGZHOU UNIV

Pharmaceutical composition for treating and preventing respiratory tract pathogen infection and application

The invention discloses a pharmaceutical composition for treating and preventing respiratory tract pathogen infection and application, and relates to the technical field of respiratory tract diseases. The inventor finds new application of rotenone. In-vitro and in-vivo experiments prove that the rotenone can reduce the virus titer of human laryngocarcinoma epithelial cells infected by human respiratory syncytial virus (HRSV), improve the survival rate of animals and promote the weight of the infected animals to be gradually increased from low level. Tests prove that the rotenone has a good effect of resisting respiratory pathogens (especially respiratory infection viruses), has a good application prospect when being used for treating and / or preventing respiratory pathogen infection, and can be developed into corresponding drugs for treating or preventing respiratory pathogen infection. And good news is brought to pneumonia patients such as viral pneumonia.
Owner:GUIZHOU MEDICAL UNIV

Human antibodies, pharmaceutical compositions and methods

Pharmaceutical composition comprising antibodies or antigen binding fragments thereof that bind to Globo H, stage-specific embryonic antigen 3 (SSEA-3) and stage-specific embryonic antigen 4 (SSEA-4)are disclosed herein, as well as methods of use thereof. Methods of use include, without limitation, cancer therapies and diagnostics. The antibodies of the disclosure can bind to certain cancer cellsurfaces. Exemplary targets of the antibodies disclosed herein can include carcinomas, such as sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, head-and-neck cancer, nasopharyngeal cancer, esophagus cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, intestinal cancer, colorectal cancer, kidney cancer, cervix cancer, endometrial cancer, ovarian cancer, testical cancer, buccal cancer, oropharyngeal cancer, laryngeal cancer and prostate cancer.
Owner:OBI PHARMA

Molecular markers related to the occurrence and development of laryngeal cancer

The invention discloses a molecular marker related to incidence and development of laryngeal carcinoma. The molecular marker is LOC100507437. According to the molecular marker related to incidence anddevelopment of laryngeal carcinoma, QPCR research proves that expression of LOC100507437 in laryngeal squamous cell carcinoma tissue is significantly up-regulated compared with those of control groups, and according to the differential expression characteristic of LOC100507437, LOC100507437 can be used as the molecular marker for diagnosing laryngeal squamous cell carcinoma. Moreover, an in-vitroexperiment proves that expression of LOC100507437 is related to proliferation and migration of laryngeal squamous cell carcinoma so that LOC100507437 can be used as a molecular target for treating laryngeal squamous cell carcinoma.
Owner:BEIJING MEDINTELL BIOMED CO LTD

Anticancer activity of imino acid conjugates of methylglyoxal

The invention relates to the use of imino acid conjugates of methylglyoxal for the inhibition and / or treatment of cancer. The invention relates more specifically to the use imino acid conjugates of methylglyoxal for inhibition and / or treatment of cancer of the Colon, Prostate, Larynx, Kidney, Pancreas, Lung, Breast, Intestine, Oral cavity, Ovary, Glioblastoma, and Leukemia. The invention also relates to compositions and methods of inhibiting cancer using imino acid conjugates of methylglyoxal.
Owner:DABUR RESEARCH FOUNDATION

Biomarkers of oral, pharyngeal and laryngeal cancers

Provided herein are methods for detecting a head and neck cancer of the oral cavity or throat, optionally oral squamous cell carcinoma, comprising executing the step of determining the expression of two or more miRNA in a biological sample obtained from a subject, wherein the two or more miRNA are selected from the group consisting of hsa-let-7a, hsa-miR-16, hsa-miR-21, hsa-miR-451, hsa-miR-486-5pand hsa-miR-92a- 3p, and wherein the level of expression of said two or more niiRNAs in the biological sample relative to the level of expression of said two or more miRNAs in one or more cancer-freereference samples is indicative of the presence of a head and neck cancer of the oral cavity or throat of the subject.
Owner:N 特兰 +1

Pharmaceutical composition for treating laryngeal cancer, its preparation method and application

The invention relates to the technical field of anticancer drugs, in particular to a pharmaceutical composition for treating laryngeal cancer, a preparation method and application thereof. The active ingredients of the pharmaceutical composition include biflavones of spicantia chinensis, biflavones of ginkgo biloba, biflavones of cypresses, biflavones of bamboo and cypresses, 7‑desmethyl biflavones of ginkgo biloba and 7,4',7", 4"'‑tetramethoxy Biflavonoids of Suicha fir. The pharmaceutical composition has good effect on treating laryngeal cancer.
Owner:SOUTH CENTRAL UNIVERSITY FOR NATIONALITIES

Use of interferon alpha-1a in the preparation of medicines for treating cancer

The application relates to application of interferon alpha-1a in preparing drugs for treating cancer, specifically to the application of the interferon alpha-1a in preparing drugs for treating cervical cancer, laryngeal carcinoma and pancreatic cancer. The interferon alpha-1a can obviously inhibit the proliferation of HeLa, HeG2, SW1990 and MIA-PaCa-2 cells and promote apoptosis of the cells. Theresult suggests that the interferon alpha-1a possibly has the characteristics and potential of resisting the cervical cancer, the laryngeal carcinoma and the pancreatic cancer and provides a new clueand theoretical basis for clinical treatment of cancer.
Owner:THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI

Molecular marker related to incidence and development of laryngeal carcinoma

The invention discloses a molecular marker related to incidence and development of laryngeal carcinoma. The molecular marker is LOC100507437. According to the molecular marker related to incidence anddevelopment of laryngeal carcinoma, QPCR research proves that expression of LOC100507437 in laryngeal squamous cell carcinoma tissue is significantly up-regulated compared with those of control groups, and according to the differential expression characteristic of LOC100507437, LOC100507437 can be used as the molecular marker for diagnosing laryngeal squamous cell carcinoma. Moreover, an in-vitroexperiment proves that expression of LOC100507437 is related to proliferation and migration of laryngeal squamous cell carcinoma so that LOC100507437 can be used as a molecular target for treating laryngeal squamous cell carcinoma.
Owner:BEIJING MEDINTELL BIOMED CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More