48 results about "Influenza A (H1N1) virus" patented technology

The invention relates to a method for detecting the pathogenicity of an influenza A (H1N1) virus based on pyrosequencing. The method comprises the steps of carrying out RT-PCR (Reverse Transcription-Polymerase Chain Reaction) amplification on a hemagglutinin (HA) gene of an H1N1 virus; carrying out pyrosequencing on a PCR amplification product to judge whether the cleavage site of the HA gene of the influenza A (H1N1) virus has a mutation, wherein the pyrosequencing is carried out in an SQA (Sequence Analysis) mode, and a nucleotide sampling sequence is shown as AGCT. The mutation of the cleavage site of the HA gene of the influenza A (H1N1) virus can be detected at rather high accuracy through comparing a detected result with the sequence of the cleavage site of the HA gene of a standard strain of the influenza A / H1N1 virus. The invention provides a simple and rapid experimental scheme for determining the virulence, pathogenicity and host range of the virus, the complex experiment steps related to complete genome sequencing are omitted, the variation direction of the virus can also be accurately mastered, the virus is conveniently monitored, an infection source is isolated, a transmission route is cut off, and the further development of an epidemic situation is stopped.

The invention discloses full-gene sequence primers for determining influenza A H1N1 viruses and a determination method. The invention relates to 48 pairs of primers with strong specificity, high sensitivity and good stability, which are used for determining 8 fragments of gene sequences of the influenza A H1N1 viruses, wherein the 8 fragments comprise HA, NA, NP, M1, M2, PA, PB1 and PB2. The method for detection by utilizing the 48 pairs of primers has the advantages of simple operation, short time consumption, strong specificity and high sensitivity and is suitable for identification of the influenza A H1N1 viruses, epidemiological survey and research and the like.

The invention relates to the field of virology, in particular to a recombinant baculovirus which is manually modified and synthesized and contains a main immunogenic gene HA-NA-M1 of an influenza A H1N1 virus. The strain QP-Ac-HNM1 belongs to the baculovirus (Baculovirus) and is preserved in the China Center for Type Culture Collection (CCTCC) with the preserving number of CCTCC-V200912. The recombinant virus is capable of synchronously expressing the HA and NA of the influenza A H1N1 virus and M1 proteins to form virus particles which can be used for developing vaccines so as to prevent human beings and swine from being infected with the influenza A H1N1 virus.

The invention discloses a closed type DNA fluorescent biosensor and its application in detecting influenza A H1N1 virus. The sensor includes an auxiliary probe, a signal probe and a fluorescent dye that can specifically bind to the signal probe; wherein, the sequence of the signal probe is 5'-TCCTATTGTGACTTTGGGTAGGG CGGGTTGGG-3'; the sequence of the auxiliary probe is 5'- GCCCTACCCGGGTGTTATATTCTG‑3'. The enclosed DNA fluorescent biosensor of the invention can rapidly detect the concentration of the specific single-stranded DNA sequence of the influenza A H1N1 virus through the change of the fluorescence value, has high sensitivity, good specificity, is convenient for standardized operation, and is suitable for clinical screening, etc. The advantages of the invention provide certain theoretical guidance for the development of rapid detection products for influenza A H1N1 virus, and are of great significance to the clinical monitoring of epidemic viruses.