Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, probe and method for detecting resistance mutation of influenza A H1N1 viruses

An influenza virus and drug resistance technology, applied in primers and probes and fields for detecting drug resistance mutation of influenza A H1N1 virus, can solve the problems of affecting sensitivity and specificity, expensive, laborious, etc., and achieve strong sensitivity and specificity. Good performance and clear results

Inactive Publication Date: 2010-12-29
ZHEJIANG CENT FOR DISEASE CONTROL & PREVENTION
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, a variety of methods for detecting influenza viruses with oseltamivir-resistant genotypes using molecular biological methods have been established, such as single nucleotide polymorphism analysis, rolling circle amplification technology, and Sanger sequencing, etc., but these methods not only Time-consuming, labor-intensive, relatively expensive, and its sensitivity and specificity will be affected by differences in laboratories, staff, operating methods and specimens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and method for detecting resistance mutation of influenza A H1N1 viruses
  • Primer, probe and method for detecting resistance mutation of influenza A H1N1 viruses
  • Primer, probe and method for detecting resistance mutation of influenza A H1N1 viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Design of primers and probes

[0043] Compare the influenza NA gene sequences registered in GenBank and design primers and probes accordingly. Wherein the primer sequence is:

[0044] PN1H274Y-F: 5'-AGGCCTCATACAAGATCTTCAGAATA-3';

[0045] PN1H274Y-R: 5'-AAGACACCCACGGTCGATTC-3',

[0046] They are respectively located on both sides of the 823-825 mutation site, and the length of the amplified fragment is 168bp.

[0047] The probe sequence is:

[0048] PN1H274-Pb1: 5'-HEX-ATGCCCCTAATTAT C ACTA-MGBNFQ-3';

[0049] PN1H274Y-Pb2: 5’-FAM-AATGCCCCTAATTAT T ACTA-MGBNFQ-3'.

[0050] They are complementary to the sequences at positions 823-825 and both ends, respectively, wherein the fluorescent group is located at the 5' end of the probe, and the MGB is located at the 3' end.

Embodiment 2

[0051] Example 2: Artificial synthesis of RNA comprising 274 wild-type or mutant coding sequences

[0052] Use PN1H274Y-F and PN1H274Y-R primers to amplify 274H wild-type DNA fragments from clinically isolated samples, use PN1H274Y-F and 274Rm (GCATTCCTCATAGTAATAATTAGGG) primers containing mutation sites, 274Y-Fm (CCCTAATTATTACTATGAGGAATGC) containing mutation sites and PN1H274Y-R amplifies the 5' and 3' end fragments of the mutation site respectively, then the purified and recovered fragments are mixed as templates, and PN1H274Y-F and PN1H274Y-R are used as primers for amplification to obtain fragments containing 274Y mutation. The mutant and wild-type fragments were cloned into pGEM-Teasy (Promega) vector (pGEM-Teasy-274Y, pGEM-Teasy-274H) for sequencing.

[0053]The gene fragments of assembly protein and coat protein of MS2 phage were amplified with primers CTAGATCTCCTTTCGGGGTCCTGCTCAACTT and TTGGATCCGAGTTGAACTTCTTTGTTGTCTTC, and then digested with BglII and BamHI. The dige...

Embodiment 3

[0054] Embodiment 3: the specific detection of this method

[0055] Using seasonal influenza H1N1, H3N2 and type B influenza, highly pathogenic avian influenza H5N1 of human origin and H9N2 virus RNA of avian origin as templates, and 10 4 The diluted H274Y wild-type and mutant RNA mixture was used as a template for specific detection.

[0056] The composition of the PCR reaction solution is as follows (using TaKaRa one-step fluorescent quantitative RT-PCR kit, ABI 7500 fluorescent quantitative PCR instrument):

[0057] 2×One Step RT-PCR Buffer 12.5μL

[0058] PN1H274Y-F 0.4 μM

[0059] PN1H274Y-R 0.4 μM

[0060] PN1H274-Pb1 0.2 μM

[0061] PN1H274Y-Pb2 0.2 μM

[0062] ROX TM Normalizing reference dye 0.5 μL

[0063] TaKaRa Ex Taq TM HS 0.5 μL

[0064] PrimeScript TM RT Enzyme Mix 0.5μL

[0065] Sample RNA 5 μL

[0066] Make up to 25 μL with DEPC-treated water, and mix well;

[0067] The reaction program was reverse transcription at 42°C for 30 minutes; pre-denat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific amplification primer and a fluorescent probe for detecting the resistance mutation of influenza A H1N1 viruses, application thereof, and a method for detecting the resistance mutation of the influenza A H1N1 viruses. When the method of the invention is in use, an operation process is simple and a result is visual and clear; the primer and the probe have high sensitivity and high specificity; whether the influenza flu is a resistant mutant can be identified in the influenza detection and monitoring quickly; and thus, labor and material consumption is greatly reduced.

Description

(1) Technical field [0001] The invention relates to a group of specific amplification primers and fluorescent probes for detecting drug-resistant mutations of influenza A (H1N1) virus and their application, as well as a method for detecting drug-resistant mutations of influenza A (H1N1) viruses. (2) Background technology [0002] Influenza (influenza) is an acute infectious disease caused by influenza virus among humans, poultry, and animals. Its morbidity, mortality and economic losses rank first among all infectious diseases. Oseltamivir (trade name: Tamiflu) is widely used as the prevention and treatment of influenza, but the influenza virus has a significant oseltamivir mutation due to the mutation of histidine at position 274 of neuraminidase to tyrosine. drug resistance. At present, a variety of methods for detecting influenza viruses with oseltamivir-resistant genotypes using molecular biological methods have been established, such as single nucleotide polymorphism a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11G01N21/64
Inventor 陈寅张严峻卢亦愚茅海燕周敏
Owner ZHEJIANG CENT FOR DISEASE CONTROL & PREVENTION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com