110 results about "Susceptible population" patented technology

The invention establishes a nonlinear and coefficient variation infectious disease predictive model aiming at epidemic diseases with viruses which have infectivity at a latent period and a period of onset, provides an epidemic situation control function directly related to the model, simulating and predicting effects of different control measures and different control degrees on the basis of prediction in consideration of the control measures, considers the epidemic situation control as a continuous change process, integrally simulating and predicting development and control of the epidemic situation and provides crucial quantitative information for decision-making departments to optimally decide and control the epidemic situation with the smallest cost. By adopting the invention, a relative error for simulating SARS (Severe Acute Respiratory Syndromes) in Beijing areas in 2003 is 0.98% and predictive results for influenza A virus subtype H1N1 in US and Japan are well matched with the actual epidemic situation development, a quantified control factor for preventing the influenza A virus subtype H1N1 at an initial development stage and controlling the spread of the epidemic situation is obtained and epidemic situation development conditions of different control intensities and different susceptible people are predicted.

The invention discloses a composite IgY antibody for resisting COVID-19 and SARS. The antibody is prepared by the following method: constructing a recombinant antigen of SARS-CoV-2 and SARS-CoV; preparing an immune preparation with the recombinant antigen to immunize egg-producing birds, and obtaining the specific composite IgY antibody from the immunized eggs. A spray prepared by the antibody canbe used for broad-spectrum killing of SARS-CoV-2 and SARS-CoV, and is suitable for spraying on nasal cavity, oral cavity, skin and other parts. The antibody preparation has a specific virus neutralizing effect, can effectively control infection sources, protect susceptible people, disinfect and protect first-line medical staff and prevent spread of SARS-CoV-2.

The invention discloses a BRCA gene susceptibility SNP locus detection composition. The BRCA gene susceptibility SNP locus detection composition comprises a primer of SEQ NO:1-SEQ NO:448. The BRCA gene susceptibility SNP locus detection composition has the advantages that more than two thousand susceptibility SNP loci of a BRCA gene can be detected at one time, for the susceptibility SNP loci relative to breast cancer and ovarian cancer, the detection throughput is high, the specificity is strong, the pollution is not prone to occur, and the safety is high, the detection result has good accuracy and repeatability, and certain auxiliary diagnosis and implication effects are achieved for susceptible population of the breast cancer and the ovarian cancer, especially for crowd with family heredity of the two cancers.

The invention provides an infectious disease dynamics model based on a machine learning algorithm and an analysis method. The method comprises the steps: S1, building an SEIR model, and carrying out classification on crowds in a target region according to a virus infection state, the crowds including susceptible crowds, latent crowds, infection confirmation crowds and rehabilitation crowds; S2, according to a preset propagation process, fitting an infection probability, and simulating a virus infection process; and S3, upgrading and optimizing the constructed SEIR model, including: introducingvirus characteristic analysis, and correcting the virus infection process; introducing human intervention factors, and simulating an inter-group infection process; and obtaining a corrected model, generating propagation trend data by using the corrected model, and outputting an infectious disease related population quantity situation curve.

The invention discloses a gene combination, a primer and a probe used for detecting the susceptibility of femoral head necrosis, and application. The gene combination comprises six genes, namely a VEGF gene of vascular endothelial growth factors, an FV gene and an MTHER gene of blood coagulation factors, a PON1 gene, an APOA1 gene and an APOB gene of lipid metabolism genes, which are closely related to the femoral head necrosis. The existence of a femoral head necrosis susceptibility gene of detected population is comprehensively detected and analyzed by detecting a group of genes and loci which are related to the susceptibility of the femoral head necrosis, utilizing a specific primer and the probe and combining single-nucleotide extending technology with microarray chip technology, and the femoral head necrosis susceptible population is screened from the population for changing improper living habits, so as to fulfill the aim of prevention.

The invention discloses a palm color analysis method for health state identification. The palm color analysis method for the health state identification comprises firstly collecting palm image information of two hands of a tester; computing collected palm color parameters; judging whether the tester belongs to the weak susceptible population according to a palm color parameter computing result of the two hands of the tester or not. According to the palm color analysis method for the health state identification, the current health state of the tester is visually and simply confirmed after the palm color information of the two hands of the tester is collected, the tester can clearly understand personal physical states, and reference is provided for health care scheme planning.

The invention relates to a susceptibility gene region closely related to psoriasis and a method for detecting psoriasis susceptible population. The susceptibility gene region contains 7 genes, that is, LCE3A, LCE3B, LCE3C, LCE3D, LCE3E, LCE2C and LCE2D. The method for detecting psoriasis susceptible population by the region is realized by the following steps: extracting genome DNA; amplifying PCR; purifying by SAP alkaline phosphatase; allowing single base extension reaction of SNP sites according to a UEP primer designed by the SNP sites in the region; scanning by a mass spectrometer, judging difference of the SNP sites in the susceptibility gene region according to different values of molecular weights of various single base extension products; and judging results. The invention discloses the susceptibility gene region closely related to psoriasis, and provides the method for accurately and effectively determining the psoriasis susceptible population according to hereditary properties of the susceptibility gene region.

The invention discloses a method for detecting fluorescence quantitative PCR genotypes of predisposing genes of hepatic cell carcinoma (HCC), which comprises the following steps: aiming at the polymorphism of a fifth intron rs430397 site of a GRP78 gene, designing a PCR reaction primer and a fluorescent probe; adding the PCR reaction primer, the fluorescent probe and PCR reaction solution to a reaction system; and placing the mixture on a fluorescence quantitative PCR instrument for reaction. The invention also discloses a kit for the method for detecting the fluorescence quantitative PCR genotypes of the predisposing genes of the hepatic cell carcinoma. The kit comprises the PCR reaction solution, the PCR reaction primer and the fluorescent probe. The method for detecting fluorescent probe genotypes of TaqMan and the kit have the advantages of simplicity, quickness, high flux and strong specificity, are applicable to large-scale screening of HCC susceptible population, provide a potential drone for gene therapy, and are advantageous for guiding the prevention and treatment of the HCC.

The invention provides a special detection tool capable of screening susceptible population of bird influenza and human influenza viruses. The detection tool is a lectin testing chip aiming at a saliva sample and adopts an epoxidation film base; two types of lectins including MAL-II (Maackia Amurensis Leukoagglutinin-II) and SNA (Sambucus Nigra Agglutinin) are fixed on the epoxidation film base by sample application. A corresponding lectin chip kit comprises the lectin testing chip, confining liquid, washing liquid and an incubation buffer solution. The invention further optimizes a preparation and treatment method of the lectin testing chip so as to establish an optimal reaction system for detecting saliva glycoprotein carbohydrate chain end sialic acid alpha2-3 and alpha2-6 carbohydrate chain structures in the saliva sample. The product provided by the invention is low in production cost and strong in testing pertinence; the inherent advantages of the lectin chip are combined to rapidly, simply and efficiently detect information of an evaluating result of the susceptible population of the bird influenza and human influenza viruses without damages.

The invention provides a mass spectrum model for detecting decayed tooth characteristic protein. The mass spectrum model comprises peaks with mass-to-charge ratios of 3324.8 m / z, 3186.2 m / z and 3195.8 m / z, wherein the protein represented as the mass-to-charge ratios of 3324.8 m / z, 3186.2 m / z and 3195.8 m / z in the model is the decayed tooth saliva characteristic protein; the down-regulated expression of the peaks of 3324.8 m / z, 3186.2 m / z and 3195.8 m / z predicts that a person belongs to the decayed tooth susceptible population. The mass spectrum model can be used for screening the decayed tooth susceptibility; the method is simple and easy to operate; the accuracy is high; a new idea is provided for screening the decayed tooth susceptibility.

The invention relates to SNP (single nucleotide polymorphisms) associated with a cervical cancer, provides a primer and a probe for detecting susceptible populations of the cervical cancer by using the SNP, and also provides a method for detecting the susceptible populations of the cervical cancer by using the SNP, the primer and the probe. The method is achieved by the following steps: genome DNA (deoxyribonucleic acid) extraction; Taqman PCR (polymerase chain reaction) augmentation of a target segment containing SNP sites; fluorescence collection and genetic typing of a PCR product; and result judgment.

The invention discloses a blood corpuscle gene marker detection method for workers exposed to noise. The biomarker is the rs77684420 locus and rs6726395 locus of a NFE2L2 gene; the rs77684420 locus ofthe NFE2L2 gene is shown as SEQ ID NO : 1-2 which is TGAAGGTTACCAATATATTAAATGC[C / T]GTGGAATCAACGATTTTTATGTTC; and the rs6726395 locus is shown as SEQ ID NO : 3-4 which is TTTAATTATTCCATCCTACCCAAGC[A / G]TACAGATGTTAGTGGATCAAATGAG. The method firstly extracts DNA from the blood corpuscle of workers in a control group matching the ages and genders of the works in a noise hearing loss group, four gene loci can be detected, and the correlation of rs77684420 locus at 5'UTR area of the NFE2L2 gene, rs6726395 locus in an intron area and haplotype GAGT polymorphism and noise hearing loss can be verified;and the gene marker taken as pre-employment screening of the workers exposed to noise is simple in operation, high in sensitivity and suitable for large scale screening of susceptible population, andtherefore, bases can be provided for the pre-employment screening of the workers exposed to noise.

The invention relates to the field of the association analysis between the gene-environmental interaction and the disease susceptibility, in particular to a method for judging the disease susceptibility of severe depression through detecting the associative action between a NET gene and negative life events. The method solves the problem that the disease susceptibility of the severe depression cannot be accurately judged yet in prior art through detecting the NET gene only or evaluating the negative life events only. First, the study object that is peripheral blood leukocyte DNA is extracted by a conventional phenol-chloroform method; the polymerase chain reaction and the direct sequencing DNA technique are adopted to detect the polymorphism of SNPs rs2242446 and rs5569 which are the NET gene; the genotype and the allele of examinees are determined; then the screening and the judgement of susceptible population are evaluated and performed through combining a life event scale so as to find that individuals are easier to be attacked by tristimania when suffering from the stimulus of certain life events, wherein, NET gene rs2242446 polymorphism basic groups of the individuals are C, and rs5569 polymorphism basic groups thereof are A.

The invention discloses a global new coronavirus propagation prediction method based on an optimized SEIRD model, and relates to the technical field of infectious disease data processing, and the method comprises the steps: A, collecting data, and building an improved SEIRD cabin model on the basis of an epidemiological SEIR model: 1, increasing the index of latent crowd infection rate, subdividing the susceptible population conversion rate in the SEIR model into a latent population infection rate and a definite population infection rate; 2, subdividing the removal rate in the SEIR model intoa death rate and a cure rate; 3, expressing the cure rate and the death rate as a time sequence function of time t; dividing crowds in the bin into five types, namely susceptible people, symptomatic latent infected people, symptomatic infected people, cured people and dead people; B, respectively carrying out parameter estimation and model fitting on the model according to a least square method, estimating an inflection point and an end date of an epidemic situation, and carrying out model inspection by using actual data. The method has the advantages of accurate prediction and good reliability.

The invention relates to a method, a device, equipment and a medium for determining a plague transmission path according to a close contact map. The method comprises the following steps: acquiring health information of a definite patient; obtaining a close contact relationship map of the definite patient; determining the disease propagation probability between the definite patient and the relatedperson according to the close contact relationship map and the health information; and determining a disease propagation path between the definite patient and the related person according to the closecontact relationship map and the disease propagation probability. By means of the technical scheme, the multi-dimensional relation information of the transmission path is more visual and accurate, the transmission path, susceptible people and the transmission range can be found more quickly, plague development is monitored more comprehensively, and prevention and treatment measures are formulatedin a targeted mode.

The invention relates to the individual susceptibility of the disease course progress of a chronic hepatitis b virus (HBV) infected person, and particularly relates to an application of a susceptible gene IL-6 SNP marker related to the disease course process progress of the HBV chronic infected person in early warning and genetic counseling of the outcome of the HBV chronic infected person. The invention provides an IL-6 gene SNP marker related to the outcome of chronic HBV and particularly related to the outcome of HBV-related hepatocirrhosis and a detection reagent and a detection method. For the chronic HBV patients having an rs2066992-site TT gene or a T allele or an rs1524107-site TT gene, scientific interference can be performed, for example, the patient is advised to take the curative prevention measures as early as possible, so that the risk of HBV-related hepatocirrhosis of susceptible people can be reduced on purpose.

The invention discloses gene combinations, a primer, a probe and applications thereof for determining PDS gene mutation of large vestibular aqueduct syndrome deafness. The gene combinations comprise combinations of the following five mutant sites of PDS genes: IVS7-2A>G, A2168G (H723R), L236P, IVS8 +1 G>A and T416P which are respectively corresponding to the following SNP (single nucleotide polymorphism) sites: the rs111033313 site, the rs121908362 site, the rs80338848 site, the rs80338849 site and the rs28939086 site. According to the applications disclosed by the invention, a group of genes and sites related to the susceptibility of large vestibular aqueduct syndrome deafness are detected, and whether the subject population carry susceptible genes of large vestibular aqueduct syndrome deafness can be detected and analyzed comprehensively by using a specific primer and a specific probe by a mononucleotide extension technology combined with a microarray chip technology, thereby screening out susceptible population of large vestibular aqueduct syndrome deafness from the subject population, and achieving the purposes of rapid diagnosis and treatment.

The invention discloses a core promotor sequence for regulating expression of a plutella xylostella Bt (Bacillus Thuringiensis) Cry1Ac insecticidal protein resistant gene MAP4K4 (Mitogen-activated Protein Kinase Kinase Kinase Kinase 4), mutation sites and application of the core promotor sequence in plutella xylostella Bt Cry1Ac insecticidal protein resistance identification and field monitoring.The mutation sites are nucleotides located at a 491 site, a 474 site and 469 to 470 sites at the upstream of an initial codon ATG and are respectively named M1, M2 and M3. A nucleotide sequence of plutella xylostella Bt Cry1Ac insecticidal protein susceptible population promotor is as shown in SEQ ID NO.1, and a nucleotide sequence of a resistance near-isogenic line population promotor is as shownin SEQ ID NO.2. An experiment verifies that the activity of a MAP4K4 gene promotor is remarkably enhanced when M2 and M3 are in mutation at the same time. According to the core promotor sequence disclosed by the invention, the research of promotor mutation in the field of insect Bt resistance is promoted, and particularly, important theoretical and practical significances in aspects of insect Btresistance field detection and control are obtained.

The invention belongs to the field of genes of a biological technology, and in particular to a single nucleotide polymorphism site relevant to susceptibility of prostate cancer and application of the single nucleotide polymorphism site. The invention provides sequences of partial genes in a genetic region 9q31.2 relevant to the susceptibility of the prostate cancer, and nucleotide sequences are shown as SEQ.ID.NO.1. The invention also provides a single nucleotide polymorphism site rs817826 on the genetic region 9q31.2, wherein individuals with rs817826 basic groups as C are prostate cancer susceptible population, individuals with rs817826 basic groups as T are prostate cancer non-susceptible population; and an SNP (Single Nucleotide Polymorphism) sequence of the rs817826 is shown in SEQ.ID.NO.2. The invention also provides specific nucleic acid primers, which are shown in SEQ.ID.NO.3, SEQ.ID.NO4 and SEQ.ID.NO.5, of the single nucleotide polymorphism site, wherein amplified products of the single nucleotide polymorphism site are specifically amplified.

The invention discloses disease susceptibility associated SNP sites, especially relates to coronary heart disease susceptibility substantially-associated SNP sites of a susceptible region chr5p15, and applications of the SNP sites in the assessment of the susceptibility of the coronary heart disease, and belongs to the biotechnological field. The SNP sites are a series of SNP sites positioned in a segment of a closely linked region of a TRIO gene region of a chromosome 5p15, comprising rs117297784, rs1058312, rs9942367, rs17500919 and rs11133787. According to a method for determining the coronary heart disease susceptible populations through the variation characteristics of the haplotype composed of the SNP sites in the TRIO gene region of the chromosome 5p15 and a series of the SNP sites, the populations without early-stage clinical symptoms of the coronary heart disease, especially coronary heart disease high-risk populations with traditional danger factors, can be non-invasively, rapidly and simply screened, so coronary heart disease susceptible objects can be early discovered, and corresponding health measures can be adopted, thereby the incidences of the coronary heart disease and myocardial infarction are reduced

The invention provides a method for detecting cerebral apoplexy drug administration and heredity correlation, according to the method, primers and probes are synthesized according to nucleotide sequences of four polymorphic sites CYP2C19*2: rs4244285; CYP2C19*3: rs4986893; CYP2C19*17: rs12248560 and PAR-1: rs168753 of two genes of cytochrome P450, and by real-time fluorescence quantitative alleleprobe detection, whether a target is a drug susceptible population is determined. Using the method, the guidance and adjustment of a clinical drug regimen can be carried out to provide a basis for clinical personalized treatment and prevent adverse drug reactions. The method can simultaneously detect the four polymorphic sites of the two genes, and has the advantages of simplicity, accuracy, rapidity and high throughput.

The invention discloses an antibody specially bound with Norovirus GII.4 genotype VP1 protein and / or VLP. The antibody comprises CDR1, CDR2 and CDR3 regions of a heavy chain variable region shown in SEQ ID NO. 1-3 and / or The CDR1, CDR2 and CDR3 regions of the light chain variable region shown in SEQ ID NO. 4-6. The antibody or antigen binding part of Norovirus GII.4 genotype VP1 protein and / or VLPprovided by the present invention, has no cross-reaction with GI.1 genotype, is high in specificity, has the characteristic of blocking binding between Norovirus GII.4 genotype VP1 protein and / or VLPand HBGA, is high in affinity, can be used for detecting the presence or level of Norovirus GII.4 genotype VP1 protein and / or VLP in a sample developing kits, as well as treating patients and performing passive immunization on susceptible populations, and has good application prospect.

The invention discloses a method for rapidly detecting an influenza susceptible population by using a sialic acid artificial antigen and a test strip. In the sialic acid artificial antigen, carrier protein is bovine serum albumin or ovalbumin; animal is immunized with the artificial antigen to obtain a corresponding antibody, which specifically binds to sialic acid in a human saliva sample. A colloidal gold immunoassay test strip which is prepared from the above antibody and a coating antigen is established in the invention, and is used for detecting sialic acid in human saliva samples to quickly determine the influenza susceptible population. The test strip of the invention has high sensitivity and strong specificity and is convenient use, and the detection result is easy to observe and distinguish. The test strip is suitable for rapid clinical measurement and large-scale application at the base level.

The invention is suitable for the technical field of infectious disease epidemic situation early warning, and provides an urban infectious disease high-risk community identification method and device,electronic equipment and a medium. The identification method comprises the steps of determining an infection source risk index of each community according to spatial feature data of high-risk crowdsof each community; determining a propagation path risk index of each community according to the utilization condition data of the living facilities of each community; according to the population feature data of each community, determining a susceptible population risk index of each community; determining a prevention capability risk index of each community according to the resource input data of the prevention and control resources of each community; and determining a high-risk community according to the infection source risk index, the propagation path risk index, the susceptible population risk index and the prevention capability risk index of each community. The problem of identifying high-risk communities can be solved, and a reference basis is provided for accurately implementing prevention and control measures and resource investment.

The invention provides a human cytochrome CYP2C19 and ABCB1 gene polymorphism site detection kit and application thereof, primers and probes are synthesized according to nucleotide sequences of four polymorphic sites CYP2C19*2: rs4244285; CYP2C19*3: rs4986893; CYP2C19*17: rs12248560 and ABCB1: rs4148727 of two genes of cytochrome P450, and by real-time fluorescence quantitative allele probe detection, whether a target is a drug susceptible population is determined. Using the method, the guidance and adjustment of a clinical drug regimen can be carried out to provide a basis for clinical personalized treatment and prevent adverse drug reactions. The method can simultaneously detect the four polymorphic sites of the two genes, and has the advantages of simplicity, accuracy, rapidity and highthroughput.

The invention discloses an antibody capable of realizing specific binding with norovirus GI.1 gene type VP1 protein and / or VLP, and a preparation method and applications thereof. The antibody containsCDR1, CDR2 and CDR3 zones containing heavy chain variable regions represented by SEQ ID NO.1-3, and / or CDR1, CDR2 and CDR3 zones containing light chain variable regions represented by SEQ ID NO.4-6.No cross reaction of the norovirus GI.1 gene type VP1 protein and / or VLP antibody or an antigen binding part with GII.4 gene type is caused; the specificity is high; the antibody is capable of blocking binding of norovirus GI.1 gene type VP1 protein and / or VLP with HBGA; the endophilicity is high; the antibody can be used for research and development of kits used for detecting existing or contentof norovirus GI.1 gene type VP1 protein and / or VLP in samples, and treatment on patients and passive immunity on susceptible population, and is promising in application prospect.

The invention provides a susceptibility gene closely related to schizophrenia, i.e. Karyopherin alpha 3 (KPNA3) gene containing two mononucleotide polymorphism sequence length of 93596bp, because accident mutation occurs on the mononucleotide polymorphism rs3782929 base C of the gene into G, it is related to the susceptibility of schizophrenia. The individuals whose rs3782929 base is G are susceptible population of schizophrenia, while the individuals whose rs3782929 base is an are not susceptible to schizophrenia.

The invention discloses a reagent kit for detecting an endometrial cancer susceptibility related genetic marker, and belongs to the technical field of molecular biology and biological medicine. The nucleotide sequence of the genetic marker is as shown in SEQID NO.1, single nucleotide polymorphism that T is greater than G exists in the 501st of the nucleotide sequence, namely that the 501st basic group of the sequence comprises two situations of a basic group T and a basic group G. The reagent kit provided by the invention contains 2 pairs of specific PCR primers designed based on single nucleotide polymorphism of a POU5F1 gene, the single nucleotide polymorphism of the POU5F1 gene is closely related to susceptibility that people suffer from endometrial cancer, through a PCR technique, thesingle nucleotide polymorphism in the POU5F1 gene can be effectively detected, and further the susceptibility of the endometrial cancer is predicted, so that the reagent kit has important clinical significance in screening endometrial cancer susceptible population, detecting high-risk individuals, and performing early prediction, early diagnosis and individualized treatment of the endometrial cancer.

The invention relates to a method and a device for detecting the susceptibility of SARS-CoV-2. The method at least comprises the following steps: separating trypsin enzymolysis peptide fragments froman extracted body fluid protease digestion sample, and quantifying ACE2 in the body fluid on the basis of the trypsin enzymolysis peptide fragments; establishing a susceptible population screening model according to the abundance distribution characteristics of the ACE2; and quantitatively comparing the ACE2 protein in the body fluid of the individual with the susceptible population screening model, and determining the susceptibility of the SARS-CoV-2. According to the method, the susceptible population screening model is established according to the abundance of ACE2, so that the susceptiblepopulation of the COVID-19 can be rapidly and efficiently screened. The method can also be applied to screening and prediction of severe risks of the COVID-19.

The invention provides a down leak-proofing fabric and a processing method thereof. WS type hot melt adhesives are sprayed on a textile fabric to be laminated with a film-covering material, and hot-pressing treatment is performed to obtain the down leak-proofing fabric. Compared with the prior art, according to the down leak-proofing fabric, a film-covering functional fabric is prepared through ahot melt adhesive laminating process. A natural fiber fabric with good air permeability and good skin-friendly property is selected as the textile fabric, organization structures are not limited, a jacquard fabric can even be selected, and a thin film with high permeability is selected as the film-covering material. The surface of the thin film is in contact with down filling materials, and the human body is in contact with natural fiber fabric components. No chemicals are added to the contact surface of a natural fiber fabric in contact with the human body, which will not lead to phenomena such as sensitization and the like of susceptible population. Moreover, down products processed have high down leak-proofing performance, almost zero down leak of the down products is achieved, and thedown products have broad application prospects. The down leak-proofing fabric has good down leak-proofing performance and fastness and can be washed repeatedly, and the down leak-proofing performanceand wearing comfort performance are not reduced after washing 10 times.