87 results about "Gene knockout technology" patented technology

The present invention mainly relates to formation of zebrafish with hepcidin gene knocked out, by the use of CRISPR / Cas9 technology, a unique PAM region is designed, so that the hepcidin gene in the zebrafish is knocked out, and other genes are not accidentally injured. The first case of hepcidin knockout transgenic animal model zebrafish has great significance, the hepcidin is a major factor in the regulation of iron, once the hepcidin is knocked out, an animal model can be successfully molded into an iron overload animal model, the human factor intervention can be excluded, the hepcidin has great significance to iron expression researches, meanwhile compared with the traditional gene knockout technology, the CRISPR / Cas9 technology has low toxicity, high accuracy, high efficiency, short success cycle and other characteristics, and the hepcidin gene can be faster knocked out.

The invention discloses miR-124 gene knockout murine animal models. The murine animal models refer to mice with miR-124-1, miR-124-2 and miR-124-3 genes knocked out. With the adoption of a Crispr-cas9 gene knockout technology, microRNA (micro ribonucleic acid) miR-124 genes with the highest expression quantity in the brains of the mice are knocked out. The obtained mice show obvious nervous system disease states such as reduction of locomotor activity, deterioration of learning and memorizing abilities, increase of soluble amyloid beta protein and the like. Therefore, the simple, reliable and economical animal models can be provided for research of nervous system disease pathology and screening of drugs for treating nervous system diseases.

The invention discloses a method for obtaining bmp2a gene knocked-out zebra fish through CRISPR / Cas9. A novel gRNA sequence is designed between a first exon and an intron of BMP2a, the gRNA sequence is GGAGCCCATCACTAGACTCTTGG, and enzyme digestion is HinfI. Compared with a traditional gene knockout technology, the CRISPR / Cas9 technology has the advantages of low toxicity, high accuracy, high efficiency, short success cycle and the like. Therefore, the BMP2a gene can be theoretically knocked out faster.

The invention discloses a recombinant vector for the knock-in of a human Huntington gene, a construction method of the recombinant vector and application of the recombinant vector in the constructionof a model pig. According to the recombinant vector, a human mutated Huntington exon gene is knocked in a fixed point manner for the first time, a virulence gene is knocked in by virtue of a CRISPR / Cas9 technique for the first time, and a donor vector is optimized by optimizing sfRNA, so that the probability that the gene is knocked into a positive cloned cell is increased; and by combining with apig cell nucleus transplantation technique, the probability that a directly obtained positive cell is knocked into the pig is increased, and a small human Huntington gene knock-in pig is obtained, thereby proving the efficient feasibility of the method for constructing gene modified pigs. The constructed Huntington gene knock-in model pig has behavioral characteristics such as respiratory disturbance and dyskinesia similar to human Huntington diseases, and stable heritable passage can be realized, so that a reliable model is provided for the research of the human Huntington diseases; and thenumber can be guaranteed so as to realize drug screening, gene treatment, stem cell treatment and the like, and the model can be a good human disease model.

The invention relates to a method for preparing an atherosclerosis disease canine model, in particular to a method for preparing an apolipoprotein E (APOE) gene knockout disease canine model according to a gene knockout technology.

The invention discloses a construction method of an Amy1 gene knockout mouse animal model and application. An Amy1 gene knockout mouse model is constructed based on a CRISPR / Cas9 gene knockout technology. The construction method comprises the following steps: step 1, designing sgRNA and Cas9 RNA, performing in-vitro transcription to obtain mRNA, and performing microinjection of the active sgRNA and Cas9 RNA on fertilized eggs of a mouse to obtain an Amy1 gene knockout mouse; and step 2, identifying the Amy1 gene knockout mouse animal model. The method has advantages: the CRISPR / Cas9 gene knockout technology is used and the mouse animal model with the Amy1 gene knocked out is established for the first time; and a convenient and reliable animal model is provided for researching the relationbetween the Amy1 gene and related diseases.

The invention discloses a method for producing recombinant human BChE (butyrylcholinesterase) from transgenic non-human mammals by using gene knock-in and nuclear transfer technologies, and particularly provides a donor construct used for specific expression of a mammary gland. The construct integrates DNA (deoxyribose nucleic acid) coding sequences of human BChE to a specific expression protein gene locus of the mammary gland in targeted manner and performs successful transfection on non-human mammal embryo fibroblasts, juvenile and adult somatic cells or embryonic stem cells, clone is performed by using a somatic cell nuclear transfer technology so as to obtain a new individual, and the carried human BChE gene enables the mammary gland of a non-human mammal to express stably and secrete holoenzyme or a monomer of the human BChE. Recombinant protein produced with the method can be used for preventing and treating nerve poison and organic phosphorus compound poisoning as well as apnea caused by cocaine poisoning and succinylcholine, and for detecting and removing residues of organic phosphorus compounds on vegetables, other crops, various article layers and the soil.

The invention provides a construction method of an Ano5 gene knockout mouse model. A CRISPR-Cas9 gene knockout technology is adopted to remove 11th and 12th exons of the Ano5 gene. After Ano5 gene knockout, mice all have clinical symptoms of human GDD patients such as lateral bending of shin bones, hyperplasia of cortical bone, hypertrophy of lower jawbone, increasing of alkaline phosphatase in blood, and the like. The established mouse model is used to simulate the human GDD disease, is stable, has stable heredity and similar symptoms of the human GDD disease, can be applied to research on GDD pathogenesis and GDD gene therapy, and is economic, simple and reliable.