676 results about "Zebrafish" patented technology

The present invention mainly relates to formation of zebrafish with hepcidin gene knocked out, by the use of CRISPR / Cas9 technology, a unique PAM region is designed, so that the hepcidin gene in the zebrafish is knocked out, and other genes are not accidentally injured. The first case of hepcidin knockout transgenic animal model zebrafish has great significance, the hepcidin is a major factor in the regulation of iron, once the hepcidin is knocked out, an animal model can be successfully molded into an iron overload animal model, the human factor intervention can be excluded, the hepcidin has great significance to iron expression researches, meanwhile compared with the traditional gene knockout technology, the CRISPR / Cas9 technology has low toxicity, high accuracy, high efficiency, short success cycle and other characteristics, and the hepcidin gene can be faster knocked out.

The invention relates to a Crispr / Cas9-induced scale-missing zebra fish mode. The mode is scale-missing zebra fish containing EDA gene exon 4-locus base insertion. Meanwhile, the invention also discloses an establishment method and the application of the Crispr / Cas9-induced scale-missing zebra fish mode. The established scale-missing zebra fish mode has a great application value in functional research of related genes of appendages of the skin, screening of medicines for treating ectoderm dysplasia such as human baldness, and the like.

The invention discloses an IL7R gene-deleted zebra fish mutant and a preparation method thereof. The construction of the IL7R gene-deleted zebra fish mutant is realized through a CRISPR / Cas9 technology. Moreover, the invention also discloses application of the IL7R gene-deleted zebra fish mutant; a mutant model provided by the invention can be used for studying an effect of IL7R in the nervous system development and myelination.

The invention discloses a method for obtaining bmp2a gene knocked-out zebra fish through CRISPR / Cas9. A novel gRNA sequence is designed between a first exon and an intron of BMP2a, the gRNA sequence is GGAGCCCATCACTAGACTCTTGG, and enzyme digestion is HinfI. Compared with a traditional gene knockout technology, the CRISPR / Cas9 technology has the advantages of low toxicity, high accuracy, high efficiency, short success cycle and the like. Therefore, the BMP2a gene can be theoretically knocked out faster.

Positional cloning has been carried out to identify the gene responsible for the hypochromic anemia of the zebrafish mutant weissherbst. The gene, ferroportin1, encodes a novel multiple-transmembrane domain protein, expressed in the yolk sac. Zebrafish ferroportin1 is required for the transport of iron from maternally-derived yolk stores to the circulation, and functions as an iron exporter when expressed in Xenopus oocytes. Human and mouse homologs of the ferroportin1 gene have been identified. The invention includes isolated polynucleotides, vectors and host cells comprising nucleotide sequences encoding Ferroportin1 proteins and variants thereof, including those having iron transport function. The invention also includes polypeptides encoded by ferroportin1 genes and variants of such polypeptides, and fusion polypeptides comprising a Ferroportin1 or a portion thereof. Methods to produce a Ferroportin1, methods to produce antibodies to a Ferroportin1 and methods to identify agents binding to a Ferroportin1, which can be inhibitors or enhancers of Ferroportin1 iron transport activity, are also described. Inhibitors of Ferroportin1 activity can be used in a therapy for hemochromatosis.

A method for studying toxicity of drugs by using model organism zebra fish comprises the following steps of: selecting 100 to 200 adult zebra fishes, respectively disposing in bottles containing a solution of 30 to 50 mL, keeping the temperature in the bottles substantially constant at 22 to 25 DEG C, randomly grouping, each group containing 10 to 20 fishes, wherein the solution in one of the groups is pure water (blank), the solutions in other groups are medicinal solutions with different concentrations, and 0.5% to 2% dimethylsulfoxide (DMSO) can be added to assist dissolving a drug that has poor water solubility, when an additional solvent comparison group prepared by adding 0.5% to 2% DMSO into the pure water is needed; recording the death number of zebra fishes in the medicinal solutions of different concentrations within 24 h, and calculating the death rate (%); calculating median lethal dose-LD50 by Bliss method according to the experiment result; and representing the acute toxicity by the value of LD50. According to the method, the LD50s of zebra fish of triptolide, matrine and emodin are respectively 5.39*10<-3>, 112.3 and 1.08*10<3> mug / mL. The method can objectively reflect the toxicity of drugs.

Provided are non-human animal model systems for viral pathogenesis of neurodegeneration, autoimmune demyelination, and autoimmune diseases such as diseases of the central nervous system, including multiple sclerosis (MS), and diabetes. Such non-human animal model systems may be suitably employed for the study of diseases such as MS and diabetes and for the identification and characterization of candidate therapeutic compounds and compositions for the treatment of such diseases. Also provided herein are markers and methods for the detection, in patients susceptible to autoimmune disease, of autoimmune diseases of the central nervous system such as progressive multifocal leukoencephalopathy (PML) following treatment with one or more therapeutic agent as exemplified herein by the therapeutic agent natalizumab. Exemplary animal model systems comprise marmosets infected with a herpesvirus such as HHV6-A and HHV6-B, transgenic mouse and zebrafish animal model systems wherein the transgene encodes CD46, and methods for monitoring the risks of patients having MS, diabetes and other auto-immune disorders treated with anti-adhesion molecules such as natalizumab.

The present invention provides methods of screening an agent for activity using teleosts. Methods of screening an agent for angiogenesis activity, toxic activity and an effect cell death activity in teleosts are provided. Methods of screening an agent for an activity in the brain or central nervous system in zebrafish are provided. The invention further provides high throughput methods of screening agents in multi-well plates.

The invention discloses lactobacillus rhamnosus NX-2 and an application thereof in preparation of uric acid reducing drugs, and belongs to the technical field of microorganisms. The lactobacillus rhamnosus NX-2 disclosed by the invention has a preservation number of CGMCC No.20110. Non-inactivated and inactivated fermentation supernate, bacterial suspension and cell disruption material supernate of the lactobacillus rhamnosus NX-2 have uric acid reducing effects on a zebrafish high-uric-acid model, and can inhibit the activity of xanthine oxidase in the body of a high-uric-acid zebrafish. Thelactobacillus rhamnosus NX-2 disclosed by the invention has a huge potential application prospect in the aspect of preparing medicines for treating and / or preventing hyperuricemia.

The invention discloses a method for determining biotoxicity of water quanlity based on movement velocity change of zebrafish. The method comprises the following steps: domesticating zebrafish; carrying out acute toxicity test on the domesticated zebrafish and calculating the 48 hour medial lethal concentration; and carrying out behavior test on the domesticated zebrafish, determining the movement velocity change of the zebrafish and judging the biotoxicity of water quality. With movement velocity of the zebrafish in a water environment as a biomarker, the biotoxicity of pollutants is evaluated; the movement behavior of the zebrafish in the water environment is tracked and captured; the movement track of the zebrafish is visually observed at any time; the speed index is determined in real time; quantitative evaluation for determining the biotoxicity of water quality by employing the zebrafish movement velocity change is realized; water quality fluctuation is displayed within a short period of time; the biological monitoring and early warning timeliness, sensitivity and accuracy are improved; a technical support is provided for sudden water body pollution; and the water supply quality safety is ensured.