Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

30 results about "Knockout rat" patented technology

A knockout rat is a genetically engineered rat with a single gene turned off through a targeted mutation (gene trapping) used for academic and pharmaceutical research. Knockout rats can mimic human diseases and are important tools for studying gene function (functional genomics) and for drug discovery and development. The production of knockout rats was not economically or technically feasible until 2008.

Method for establishing obese rat animal model based on CRISPR (clustered regularly interspaced short palindromic repeat) gene knockout technology

InactiveCN103614415AImprove the level ofDeepen understanding of gene regulationVector-based foreign material introductionAnimal husbandryDiseaseLepr gene
The invention provides a method for establishing an obese rat animal model based on a CRISPR (clustered regularly interspaced short palindromic repeat) gene knockout technology. The method comprises the following steps: (1) establishing an Lep / Lepr gene knockout rat model; (2) carrying out the authentication and related analysis on the obese rat animal model; (3) evaluating the energy metabolism and the body fat rate of the obese rat animal model. According to the method, a CRISPR / Cas system is used for respectively or simultaneously knocking out Lep and LepR genes so as to obtain the rat model modified by a corresponding target gene, so that the understanding of gene regulation in the obesity morbidity process can be deepened, and the high-level animal model can be provided for the translational medicine and the new medicine research and development.
Owner:SUZHOU TONGSHAN BIO TECH

Method for targeted knockout of specific gene of Suqin yellow chicken embryonic stem cell

The invention discloses a method for targeted knockout of a specific gene of a Suqin yellow chicken embryonic stem cell. The method comprises the following steps: firstly, checking out an exon sequence of a gene, cloning the gene, sequencing to obtain a complete exon sequence, designing a CRISPR / Cas9 knockout target site on the sequence as gRNA, and constructing a CRISPR / Cas9 dual-promoter knockout vector; performing SSA activity detection on the constructed Cas9 vector, transfecting a control group with an empty vector, detecting a luciferase signal, and obtaining a result that the more the luciferase activity is increased relative to the control group, the higher the gRNA shearing activity is shown; transfecting the CRISPR / Cas9 vector which is high in SSA activity with ESCs, using flow cytometry to screen a GFP-positive cell, extracting genome DNA, and designing a primer.
Owner:YANGZHOU UNIV

Cultivation method of Cyp gene knocked-out rats, and preparation method of liver microsome of the rats

The invention provides a cultivation method of Cyp gene knocked-out rats, and a preparation method of liver microsome of the rats. The Cyp gene knock-out herein includes Cyp single gene knock-out and Cyp multiple gene knock-out. In the method, firstly a Cyp gene knocked-out rat is constructed by means of a CRISPR / Cas system, which includes selection of a knocked-out target site, in-vitro synthesis and transcription of sg RNA and Cas9m RNA, preparation of a pseudopregnant female rat, in-vitro micro-injection and transplanting of a single-cell embryo, and cultivation of the rat, and finally, a homozygote Cyp gene knocked-out rat can be cultured. Furthermore, the liver of the Cyp gene knocked-out rat is extracted and is subjected to homogenization and differential centrifugation to prepare the liver microsome of the rat in Cyp gene deletion. The invention also provides an application of the Cyp gene knocked-out rats and the liver microsome thereof in study on drug metabolism.
Owner:EAST CHINA NORMAL UNIV

Caco-2 cell model for CRISPR/CAS9-mediated drug transporter targeted knockout and method thereof

The invention discloses a caco-2 cell model for CRISPR / CAS9-mediated drug transporter targeted knockout and a method thereof. The method is used for non-diagnostic or therapeutic purposes and comprises the following steps: designing sgRNA with target specificity for P-gp, BCRP and MRP2 transporters and constructing a sgRNA expression vector, wherein a sequence of the designed sgRNA is shown as SEQID NO. 1-6 in a sequence table; respectively designing P-gp, BCRP and MRP gene single knockout and pairwise combination double knockout by utilizing CRISPR / CAS9, co-transfecting a caco-2 cell with anhCas9 plasmid and performing monoclonal expansion culture to obtain the caco-2 cell model for transporter gene targeting. The caco-2 cell model obtained by the method disclosed by the invention has the beneficial effects that the mutual interference among different transporters is effectively eliminated, and a more specific and more sensitive cell model is provided for drug transport research.
Owner:SOUTH CHINA UNIV OF TECH

Method for establishing CYP2D1 gene knockout rat model

The invention relates to a method for establishing a CYP2D1 gene knockout rat model, and belongs to the technical field of transgenosis. The method comprises the steps of firstly determining a target point of a to-be-knocked gene and designing and synthesizing a primer sequence of the gene; inserting the primer sequence into a Cas9-gRNA-Bsal carrier subjected to enzyme digestion and performing amplification to obtain a target point sgRNA with a T7 promoter sequence; after in vitro transcription and purification, performing activity detection; micro-injecting active sgRNA and Cas9 RNA into a rat single-cell embryo to obtain a Founder rat; and after screening out a CYP2D1 gene knockout rat heterozygote, performing mating to obtain a homozygote individual, namely, a CYP2D1 gene knockout rat. The invention provides a preparation method replacing a mouse model with a P450 gene knockout rat model, so that a gene knockout technology is really fused in non-clinical safety evaluation of drugs and early toxicity of candidate drugs can be discovered.
Owner:JIANGSU UNIV

Method for establishing CYP2C11 gene knockout rat model

The invention relates to a method for establishing a CYP2C11 gene knockout rat model, and belongs to the technical field of transgenosis. The method comprises the steps of firstly determining a target point of a to-be-knocked gene and designing and synthesizing a primer sequence of the gene; inserting the primer sequence into a Cas9-gRNA-Bsal carrier subjected to enzyme digestion and performing amplification to obtain a target point sgRNA with a T7 promoter sequence; after in vitro transcription and purification, performing activity detection; micro-injecting active sgRNA and Cas9 RNA into a rat single-cell embryo to obtain a Founder rat; and after screening out a CYP2C11 gene knockout rat heterozygote, performing mating to obtain a homozygote individual, namely, a CYP2C11 gene knockout rat. The invention provides a brand-new preparation method replacing a mouse model with a P450 gene knockout rat model, so that a gene knockout technology is really fused in non-clinical safety evaluation of drugs and early toxicity of candidate drugs can be discovered.
Owner:JIANGSU UNIV

Application of gene Mindin in hepatic ischemia reperfusion injury

ActiveCN104056282AThe role of worsening ischemia-reperfusion injuryGenetic material ingredientsDigestive systemWild typeGenetically modified mouse
The invention discloses a gene Mindin and an application of an inhibitor thereof in a hepatic ischemia reperfusion injury, and belongs to the field of functions and applications of genes. After the experiment is carried out through a hepatic ischemia reperfusion injury model by taking a gene Mindin knockout rat and a Mindin transgenosis rat with a hepatic cell specificity as experimental subjects, the result shows that the hepatic necrosis of the gene Mindin knockout rat is obviously inhibited and the hepatic function of the gene Mindin knockout rat is obviously improved in comparison with a wild-type C57 rat, but the hepatic necrosis of the Mindin transgenosis rat with the hepatic cell specificity is obviously increased and the hepatic function of the hepatic necrosis Mindin transgenosis rat is seriously deteriorated. Thus, the gene Mindin has a function of deteriorating hepatic cells, especially, the gene Mindin has the function of deteriorating the hepatic ischemia reperfusion injury. Aiming at the function of the gene Mindin, the gene Mindin can serve as a medicine target for screening medicines for treating the hepatic ischemia reperfusion injury. The inhibitor of the gene Mindin can be used for preparing the medicines for treating the hepatic ischemia reperfusion injury.
Owner:武汉惠康基因科技有限公司

Mettl3-knockout spermatogenesis disorder animal model and building method thereof

A Mettl3-knockout spermatogenesis disorder animal model and a building method thereof are provided. The method includes building a Mettl3 conditionally gene-knockout rodent by applying a CRISPR / Cas9 technique; and mating the Mettl3 conditionally gene-knockout rodent and a rodent of the same kind with germ cells capable of specific expression of Cre so as to obtain a Mettl3-knockout spermatogenesisdisorder rodent model with germ cell specificity. The model built provides new ideas and new means for the cause diagnosis, prevention and treatment of human male infertility and prevention and reduction of paternal birth defects.
Owner:CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI

Construction method of Slco1b2 gene knockout rat and application thereof

PendingCN109295104AIncrease contentNo off-targetStable introduction of DNAAnimals/human peptidesDiseaseIncreased bilirubin
The invention discloses a construction method of Slco1b2 gene knockout rat and an application thereof. According to the invention, construction of Slco1b2 gene knockout rat is carried out by using a CRISPR / Cas9 system, which includes selection of Slco1b2 knockout targets, in-vitro synthesis and transcription of sgRNA and Cas9 mRNA, preparation of pseudopregnant mother rats, in-vitro microinjectionand transplantation of single cell embryos, rat breeding and screening, and obtaining of homozygote Slco1b2 gene knockout rat. Through verification by T7EI endonuclease, the gene knockout rat prepared by the method of the invention does not generate off-target phenomenon, and in the F2-generation knockout rat of about 4 weeks, total bilirubin, direct bilirubin and indirect bilirubin content are significantly higher than that of wild type rats. The invention also proposes an application of the construction method for hyperbilirubinemia research and drug development. The method provides an effective method for researching diseases such as increased bilirubin, and provides an effective experimental tool for drug research and development, and has broad application prospects.
Owner:EAST CHINA NORMAL UNIV

Method for constructing zebra fish asap1b gene-knockout mutant by using CRISPR/Cas9 technology

The invention discloses a method for constructing a zebra fish asap1b gene-knockout mutant by using a CRISPR / Cas9 technology. The method specifically comprises the following steps: determining the position of an asap1b-gRNA-Cas9 target site where the asap1b gene is knocked out, carrying out in-vitro transcription to obtain asap1b-gRNA, introducing the asap1b-gRNA and Cas9mRNA into zebra fish fertilized eggs, and carrying out screening culture to obtain the stably-inherited asap1b gene-knockout mutant. According to the invention, according to an selected section of high-efficiency targeting sequence located at the first exon of an asap1b gene, the asap1b gene in the zebra fish is knocked out by using the CRISPR / Cas9 technology, and the asap1b gene-knockout zebra fish capable of being stablyinherited is generated. Three mutation types of asap1b gene-knockout zebra fish strains are obtained in total, Asap1b protein translation is terminated in advance in all the strains, and an animal model foundation is laid for researching functions of the asap1b gene.
Owner:SHANXI UNIV +1

Application of RAG2 gene knockout rat in establishing personalized tumor treatment model

The invention discloses application of a RAG2 gene knockout rat in establishing a personalized tumor treatment model. The personalized humanized RAG2 gene knockout rat tumor treatment model is successfully established by transplanting tumor tissues of a patient by using the RAG2 gene knockout rat as a carrier. In the treatment model, tumor models with different abnormal paths are established, so that the condition of the tumor disease of the patient is trustily simulated. Drugs and treatment methods with tumor-resisting functions are evaluated by virtue of characteristics of each patient. The method for establishing the personalized tumor treatment model by virtue of the RAG2 gene knockout rat is simple in step, and the established RAG2 gene knockout rat tumor treatment model has the advantages of being short in period, high in tumor formation rate and low in expense, and can be used for forming tumors for different types of tumor tissues, so that the model can be widely applied to personalized treatment of tumors.
Owner:INST OF LAB ANIMAL SCI CHINESE ACAD OF MEDICAL SCI

Construction method of FNDC5 gene knock-out rat model, and application

The invention discloses a construction method of an FNDC5 gene knock-out rat model, and an application. The invention discloses two sgRNAs in accordance with a FNDC5 gene of a rat, and a correspondingtarget gene sequence, and the two sgRNAs are respectively designed on FNDC5 genes Intron1 and 3'UTR. The sgRNAs can be applied to construction of a rat animal model having insulin resistance and glycometabolism disorders. The invention provides a simple reliable economic animal model making method having insulin resistance and glycometabolism disorders.
Owner:CHINA INST OF SPORT SCI

Construction method for taurine transporter gene knockout rat model based on CRISPR/Cas9 technology

The invention belongs to the technical field of bioengineering, and relates to a construction method for a taurine transporter gene knockout rat model based on a CRISPR / Cas9 technology. For a 5th exonof a TauT gene, two sgRNA effect targets are selected, two pairs of oligonucleotide chains are synthesized, and are connected to a pUC57-sgRNA expression vector recovered by BsaI digestion, an sgRNAexpression vector is obtained by construction, Cas9mRNA and sgRNA are obtained by in vitro transcription, are injected into a male nucleus and cytoplasm of SD rat fertilized eggs, and are implanted into a pseudopregnant rat body, and the TauT gene knockout rat model is obtained by breeding. The construction method provides a reliable and stable genetic engineering model for further studying the effect of taurine on a rat neurological disease model, provides a stable animal model for studying the effect of the taurine on nervous system diseases, and lays a foundation for clarifying work such asa therapeutic effect of the taurine on related diseases.
Owner:天津市环湖医院

Mettl14-knockout spermatogenesis disorder animal model and building method thereof

A Mettl14-knockout spermatogenesis disorder animal model and a building method thereof are provided. The method includes building a Mettl14 conditionally gene-knockout rodent by applying a CRISPR / Cas9technique; and mating the Mettl14 conditionally gene-knockout rodent and a rodent of the same kind with germ cells capable of specific expression of Cre so as to obtain a Mettl14-knockout spermatogenesis disorder rodent model with germ cell specificity. The model built provides new ideas and new means for the cause diagnosis, prevention and treatment of human male infertility and prevention and reduction of paternal birth defects.
Owner:CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI

Construction method for Tp53-knockout animal model, and short peptides used therein

The invention provides a pair of short peptides, a pair of transcription activator-like effectors and a pair of DNA vectors. The short peptides of the invention can realize accurate and efficient targeting of the Tp53 gene of a rat so as to rapidly acquire a Tp53-knockout rat. The invention also provides a method for knocking out the Tp53 gene and a construction method for a Tp53-knockout animal model. The acquired Tp53-knockout rat can be used for research related to tumors, including molecular biology study of tumors, research on neoplastic diseases, examination of carcinogenicity and the like, and has good application prospects.
Owner:BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD

Construction method and short peptide of tp53 gene knockout animal model

The invention provides a pair of short peptides, a pair of transcription activator-like effectors and a pair of DNA vectors. The short peptides of the invention can realize accurate and efficient targeting of the Tp53 gene of a rat so as to rapidly acquire a Tp53-knockout rat. The invention also provides a method for knocking out the Tp53 gene and a construction method for a Tp53-knockout animal model. The acquired Tp53-knockout rat can be used for research related to tumors, including molecular biology study of tumors, research on neoplastic diseases, examination of carcinogenicity and the like, and has good application prospects.
Owner:BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD

Ces2 gene knockout rat model and construction method and application thereof

The invention discloses a construction method and application of a Ces2 knockout rat model for drug metabolism research. The construction method of the Ces2 knockout rat model comprises the steps of gene knockout target selection, sgRNA synthesis, embryo microinjection, rat feeding and reproduction and the like. The homozygote Ces2 gene knockout rat model is obtained; and then Ces2 expression detection and metabolic function verification are performed on the homozygous Ces2 gene knockout rat model from the mRNA level to prove that the Ces2 gene knockout rat model is successfully constructed. ACes2a / j gene knockout rat model, the Ces2c gene knockout rat model and a Ces2a / c / j gene knockout rat model are successfully constructed through the method, and the models can serve as important toolsfor researching Ces2-related drug metabolism and are important animal models for researching Ces2 physiological functions.
Owner:EAST CHINA NORMAL UNIVERSITY

Cultivation method of cyp gene knockout rat and preparation method of liver microsome

The invention provides a cultivation method of Cyp gene knocked-out rats, and a preparation method of liver microsome of the rats. The Cyp gene knock-out herein includes Cyp single gene knock-out and Cyp multiple gene knock-out. In the method, firstly a Cyp gene knocked-out rat is constructed by means of a CRISPR / Cas system, which includes selection of a knocked-out target site, in-vitro synthesis and transcription of sg RNA and Cas9m RNA, preparation of a pseudopregnant female rat, in-vitro micro-injection and transplanting of a single-cell embryo, and cultivation of the rat, and finally, a homozygote Cyp gene knocked-out rat can be cultured. Furthermore, the liver of the Cyp gene knocked-out rat is extracted and is subjected to homogenization and differential centrifugation to prepare the liver microsome of the rat in Cyp gene deletion. The invention also provides an application of the Cyp gene knocked-out rats and the liver microsome thereof in study on drug metabolism.
Owner:EAST CHINA NORMAL UNIV

Construction method for Il2rg-knockout animal model, and short peptides used therein

The invention provides a pair of short peptides, a pair of transcription activator-like effectors and a pair of DNA vectors. The short peptides of the invention can realize accurate and efficient targeting of the Il2rg gene of a rat so as to rapidly acquire an Il2rg-knockout rat. The invention also provides a method for knocking out the Il2rg gene and a construction method for an Il2rg-knockout animal model. The acquired Il2rg-knockout rat can be used for research on allotransplantation of tumors, development of humanized rats and research on autoimmune and infectious diseases, and has good application prospects.
Owner:BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD

Mdr1a/1b double-gene knockout method and application

The invention discloses an Mdr1a / 1b double-gene knockout method. An Mdr1a / 1b double-gene knockout rat model is successfully constructed, and a new animal model is provided for research of functions ofP-glycoprotein (P-glycoprotein, P-gp) such as transfer of mediated medicines. According to the method, gene knockout of rat P-gp is firstly implemented by the aid of CRISPR / Cas9 technique, an F0-generation chimeric rat is acquired by processes such as design of Mdr1a and Mdr1b target spots, sgRNA in-vitro synthesis and transcription, preparation of false pregnancy rats, oosperm in-vitro micro-injection and embryo transplantation, and breeding and screening of two generations are implemented to obtain Mdr1a / 1b double-gene knockout homozygous rats. Off-target conditions in the acquired gene knockout rats are omitted by verification of T7EI endonuclease.
Owner:EAST CHINA NORMAL UNIV

Mutation in the rat adenomatous polyposis coli gene within the human mutation hotspot region

InactiveUS7897834B2Sugar derivativesPeptidesCarcinogenAdenomatous polyposis coli
A rat with a disrupted Apc (adenomatous polyposis coli) gene is provided. The mutation can include an A to T transversion changing a lysine to a stop codon at codon 1137. Methods of generating the knockout rat are provided. Also provided is the offspring or progeny of that rat. In addition, methods of using these rats are provided, including methods for screening a carcinogen or a promoter of carcinogenesis, and methods for screening preventive and inhibitory agents of carcinogenesis.
Owner:WISCONSIN ALUMNI RES FOUND

Mutation in the rat Adenomatous Polyposis Coli gene within the human mutation hotspot region

InactiveUS20070143867A1Increased susceptibilitySugar derivativesPeptidesCarcinogenAdenomatous polyposis coli
A rat with a disrupted Apc (adenomatous polyposis coli) gene is provided. The mutation can include an A to T transversion changing a lysine to a stop codon at codon 1137. Methods of generating the knockout rat are provided. Also provided is the offspring or progeny of that rat. In addition, methods of using these rats are provided, including methods for screening a carcinogen or a promoter of carcinogenesis, and methods for screening preventive and inhibitory agents of carcinogenesis.
Owner:WISCONSIN ALUMNI RES FOUND

Plasmid composition, DNAPK gene knockout rat model building method and application

The invention discloses a plasmid composition, a DNAPK gene knockout rat model building method and application. A pair of specific transcription activator like effectors for specifically recognizing two sections of adjacent nucleotide sequences on rat DNAPK genes are built; the pair of transcription activator like effectors are used for obtaining a pair of transcription activator like effector nucleases; the rat DNAPK genes are subjected to accurate and efficient targeting; the DNAPK gene knockout rat model is further obtained.
Owner:BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD

A method for preparing ps1 gene conditional knockout flox rats

The invention provides a method for preparing flox rats for PS1 gene conditional knockout. According to the method, a conditional gene knockout carrier is built by adding Cre recombinant enzyme targeting sequence loxP loci at the two ends of a PS1 gene key exon, then a micro-injection method is conducted, and the flox rats capable of being used for PS1 gene conditional knockout are prepared. After the flox rats and Cre rats are mated, PS1 gene knockout rats with tissue specificity or inductive tissue specificity can be obtained. The conditional gene knockout method based on the CRISPR / Cas9 technology can reduce harm to other cells, and specific gene knockout can be achieved only with the need of Cre tool rats. The PS1 gene conditional knockout rats can also serve as anima models for researching the Alzheimer's disease and other diseases, and the method has important and high application value in the aspect of research of functions of the PS1 gene, particularly research of functions of the PS1 gene in nervous tissue.
Owner:BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD +1

A method and application of mdr1a/1b double gene knockout

The present invention discloses a method for Mdr1a / 1b double gene knockout, and successfully constructs a Mdr1a / 1b gene knockout rat model, in order to study the function of P-glycoprotein (P-gp), such as mediating Drug delivery provides a new animal model. The present invention utilizes CRISPR / Cas9 technology for the first time to carry out gene knockout of rat P-gp, through the process of Mdr1a and Mdr1b target design, in vitro synthesis and transcription of sgRNA, preparation of pseudopregnant mice, in vitro microinjection of fertilized eggs and embryo transfer, etc. The F0 generation chimeric mouse was obtained, and after two generations of breeding and screening, the Mdr1a / 1b double gene knockout homozygous rat was finally obtained. As verified by T7EI endonuclease, there is no off-target phenomenon in the obtained knockout rats.
Owner:EAST CHINA NORMAL UNIV

Construction method for Apoe-knockout animal model, and short peptides used therein

The invention provides a pair of short peptides, a pair of transcription activator-like effectors and a pair of DNA vectors. The short peptides of the invention can realize accurate and efficient targeting of the Apoe gene of a rat so as to rapidly acquire an Apoe-knockout rat. The invention also provides a method for knocking out the Apoe gene and a construction method for an Apoe-knockout animalmodel. The method for knocking out the Apoe gene is more reliable in gene knockout results and allows a rat to present the characteristic of hyperlipidemia in the early adult stage.
Owner:BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD

PIK3CA gene targeted-knockout sgRNA and application thereof

The invention discloses a PIK3CA gene targeted-knockout sgRNA and an application thereof. The PIK3CA gene targeted-knockout sgRNA has one of the following nucleotide sequences: a, sgRNA1: TCCGCGGCTCTAACCGCATCGGG; and b, sgRNA2: ACCCGATGCGGTTAGAGCCGCGG. The sgRNA has a high cleavage efficiency on the PIK3CA gene; and the PI3K protein expression level of a cell strain obtained through transferring aCRISPR-Cas9 system plasmid containing the sgRNA into a breast cancer SK-BR-3 cell line is significantly reduced. The sgRNA provided by the invention can realize the effective targeted knockout of thePIK3CA gene in order to facilitate the study of the action mechanism after low expression of PI3K in the cell line is facilitated, and makes an important contribution to the research of tumor cells targeting the PIK3CA gene.
Owner:KUNMING UNIV OF SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More