Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

37 results about "Transversion" patented technology

Transversion, in molecular biology, refers to a point mutation in deoxyribonucleic acid (DNA), where a single (two ring) purine is changed for a (one ring) pyrimidine, or vice versa. A transversion can be spontaneous, or can be caused by ionizing radiation or alkylating agents. It can only be reversed by a spontaneous reversion.

Enrichment and detection method of target gene fragment

The invention provides a method for enriching target gene fragments. The method comprises the following steps: (1) obtaining a partial or whole-length DNA (deoxyribonucleic acid) sample library containing a target gene; (2) obtaining a DNA probe library capable of hybridizing with the target gene; (3) hybridizing the DNA probe library and the DNA sample library; (4) separating a hybrid product obtained in the step (3), and releasing the target gene fragments subjected to hybridizing and enriching. According to the enrichment method, the invention further provides a method for detecting the gene structure mutation of the target gene. The method for detecting the gene structure mutation of the target gene comprises the following steps: (1) enriching the target gene fragments according to the method; (2) detecting the structure mutation of the target gene. The target gene fragments enriched by using the method can be used for next-generation sequencing technique to detect the gene structure mutation and comprise single-alkali base mutation, mRNA (Messenger RNA) absence or increase, mRNA structure transversion and mRNA splicing change.
Owner:GENESEEQ TECH INC

Memory system data arrangement and commutation method

InactiveCN101196797AReduce the cost of distribution transformationImprove performanceInput/output to record carriersComputer architectureDisk array
The invention discloses a data distribution and mutual conversion method of a storage system. A continuous storage space is formed by a plurality of disks, the disks also form a disk array by strips to partition the disk array into continuous storage subspaces, namely sub array, and then redundancy level can be respectively configured as zero, one, or five according to requirements; during conversion, corresponding modes are selected according to differences of transversion types. The invention has the major concept of adopting suitable data distribution mode for I / O requirements with different inquiry characteristics according to partial characteristic of I / O requirements, thereby enabling the storage system to realize optimal performance. The storage system data distribution conversion method disclosed by the invention facilitates the system being dynamically suitable for changes of I / O requirement characteristic, reduces cost caused by data distribution conversion among different redundancy levels and eliminates performance bottleneck generated by data transfer, thereby greatly improving performance of storage subsystem.
Owner:HUAZHONG UNIV OF SCI & TECH

Bovine CASTgene SNP and meat tenderness

The present invention relates to the identification of a single nucleotide polymorphism (SNP) within the bovine CAST locus encoding the calpastatin protein, wherein the allelic variation of the SNP is a G / C transversion associated with post-mortem muscle tenderness. The invention further relates to oligonucleotides useful in identifying the genotype of bovines as it relates to the CAST locus polymorphic site. The invention also encompasses computer-assisted methods and systems for improving the production efficiency for livestock having marketably tender meat using multiple data, and in particular the genotype of the animals as it relates to the CAST SNP. These methods of the invention encompass obtaining a genetic sample from each animal in a herd of livestock, determining the genotype of each animal with respect to specific quality traits as defined by a panel of at least two single polynucleotide polymorphisms (SNPs), one SNP corresponding to a site between exons 5 and 6 of the bovine CAST locus, grouping animals with like genotypes, and optionally, further sub-grouping animals based on like phenotypes.
Owner:UNIVERSITY OF GUELPH

Display device and method of displaying data thereon

The invention relates to a display device with a directional backlight. Stereoscopic images are produced by emitting light within two defined and restricted angular cones. Light is alternately sent to the viewer's left and right eyes in synchronization with switching the left and right eye images on the high-speed switching LCD. Alternatively, images can be generated for two or more observers and directed in multiple directions. The display device comprises a display panel (1), a light redirecting element (8) for guiding light through the display panel (1), a light guide (6) for guiding light towards the light redirecting element (8), A first light source (4) coupled to the light guide (6) to couple light into the light guide (6) in a first direction, and a second light source (5) coupled to the light guide (6) to couple light into the light guide (6) in a second direction Light is coupled into the light guide (6). The light redirecting element (8) has a first groove structure (9) and the light guide (6) has a second groove structure (7), the first and second groove structures (9, 7) being arranged in the following structure, The structure can guide the light from the first light source (4) through the display panel (1) with the first angular distribution (2), and guide the light from the second light source (5) through the display panel (1) with the second angular distribution (3). through the display panel (1).
Owner:LEIA INC

Adjusting device and method for transversion and pitch of adult incontinence pants

The invention relates the switching position and adjusting pitch device and adjusting method used for adult incontinence trouser, adult urine trouser, flap sanitary napkin and pad. The mother wheel which has more than two trepan borings is looped on chief axis, more than two inside spin guide groove bush is in radial trepan borings of chief axis, more than two guided stems is in inside spin guide groove bush, the pins are installed on guided stems and rotate along with inside spin guided groove, the upper end of guided stem is connected with the back of negative pressure box, the transverse guided stem is fixed by guided stem through axle sleeve, and the guide head of transverse guided is in guided groove of guided wheel. The invention has the following advantages: realizing the pitch automatic adjustment in the production process of adult incontinence trouser, adult urine trouser, flap sanitary napkin and pad, avoiding breaking the cotton fiber; the structure being novel style, unique, simple, exact, reliable and practical.
Owner:ZHEJIANG YONGCHUANG MACHINERY

Feed circuit of mainboard

A mainboard power supply circuit is provided, which is used for providing voltage for the mainboard when the mainboard exceeds frequency, and comprises a south bridge chip and a voltage transversion circuit, the voltage transversion circuit comprises an output end, the south bridge chip comprises at least one universal input output port, the each universal input output port is connected to the voltage transversion circuit through a resistance. Compared with the prior art, the mainboard power supply circuit controls output of the universal input output port through the controlling of a computer basic input output system, so as to control whether the resistance connected with the universal input output port is accessed into the voltage transversion circuit, the voltage transversion circuit can output different voltage at the output end according to the resistance value of the accessed resistance.
Owner:HONG FU JIN PRECISION IND (SHENZHEN) CO LTD +1

DNA (Deoxyribonucleic Nucleic Acid) probe library for hybridization with BCR or ABL gene and method for enriching BCR-ABL gene segments

The invention provides a DNA (Deoxyribonucleic Nucleic Acid) probe library for hybridization with a BCR or ABL gene and a method for enriching BCR-ABL gene segments. The DNA probe library comprises one or more DNA probes capable of being hybridized with the BCR or ABL genes. The invention also provides a method for enriching BCR-ABL gene segments by using the DNA probes. On this basis, the invention also provides a method for detecting whether the mutation of the BCR-ABL gene or the gene structure thereof exists. The method provided by the invention is capable of obtaining the gene segments through enrichment by thousands of times; the method can be applied to the next generation sequencing technology to detect whether the mutation of the BCR-ABL gene or the gene structure thereof exists, including single base mutation, mRNA (messenger Ribose Nucleic Acid) deletion or amplification, mRNA structure transversion and mRNA splicing change.
Owner:NANJING SHIHE MEDICAL DEVICES CO LTD

Isolated nucleotide sequences responsible for the tomato high pigment-1 mutant phenotypes (hp-1 and hp-1w) and uses thereof

The present invention provides isolated nucleotide sequences responsible for the tomato high pigment 1 (hp-1) and high pigment 1<w> (hp-1<w>) phenotypes, wherein said sequences comprises an altered tomato DDB1 gene sequence or fragment thereof, wherein said the alteration in said altered sequence or fragment comprises an A-to-T transversion at nucleotide 931 of said DDB1 gene sequence in the case of hp-1 and a G-to-A transition at nucleotide 2392 of said DDB1 gene sequence in the case of hp-1<w>.
Owner:沃尔坎尼中心-以色列农业部农业研究组织

Large yellow croaker mitochondrial molecule mark and its use in identification for cultivated population and wild population

The present invention relates to identification between cultivated population and wild population of large yellow croaker, and mitochondrial molecule mark for identification between cultivated population and wild population of large yellow croaker has difference of four bases, including one transversion and three transformatiions. The identification process includes the steps of: designing and synthesizing one pair of conservative primers L14841, 5'-CCATCCAACATCTCAGCATGATGAAA-3' and H15149, 5'-GCCCCTCAGAATGATATTTGTCCTCA-3'; PCR amplification of cytochrome gene B(cyt b) in the mitochondrial DNA of both cultivated population and wild population; purification of amplification result; and sequencing and comparing the sequencing result. The identification method is simple.
Owner:XIAMEN UNIV

DNA (Deoxyribonucleic Acid) probe library hybridized with BRAF (v-Raf murine sarcoma viral oncogene homolog B1) gene, and method for enriching BRAF gene segments by adopting same

The invention provides a DNA (Deoxyribonucleic Acid) probe library hybridized with BRAF (v-Raf murine sarcoma viral oncogene homolog B1) gene. The DNA probe library comprises one or more DNA probes which can be hybridized with the BRAF gene, each DNA probe comprises the following sequences: SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, OR SEQ ID NO.6. The invention also provides a method for enriching BRAF gene segments by adopting the same. Based on this, the invention further provides a method for detecting the gene mutation of the BRAF gene. The BRAF gene segments can be enriched by thousands of times through adopting the method, the BRAF gene segments can be used for next-generation sequencing technology for detecting gene structure mutation including single base mutation, mRNA deficiency or increase, mRNA structure transversion and mRNA splicing change.
Owner:GENESEEQ TECH INC

FGFR (fibroblast growth factor receptor) fusion gene detection method and reagent kit and probe library

The invention develops a method for capturing a specific FGFR fusion gene sequence based on hybridization selection. Through the adoption of the method, a FGFR fusion gene DNA fragment which is enriched by thousands of times can be obtained, the enriched FGFR fusion gene fragment sample can be selectively applied to various gene detection techniques and especially can be used for detection in the respects of gene mutation, deletion, increase, transversion and the like through a next-generation sequencing technique so as to obtain high-efficiency and accurate result.
Owner:GENESEEQ TECH INC +1

DNA (deoxyribonucleic acid) probe library for hybridization with EGFR (epidermal growth factor receptor) gene and method for enriching EGFR gene segments by use of same

The invention provides a DNA (deoxyribonucleic acid) probe library for hybridization with an EGFR (epidermal growth factor receptor) gene. The DNA probe library comprises one or more DNA probes which can be hybridized with the EGFR gene, and the DNA probe comprises the following sequence: SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9 or SEQ ID No.10. The invention also provides a method for enriching the EGFR gene segments by use of the DNA probe library. On the basis, the invention also provides a method for detecting the gene structure mutation of the EGFR gene. By adopting the method provided by the invention, the EGFR gene segments can be enriched by thousands of and even tens of thousands of times, and the EGFR gene segments can be applied to the next-generation sequencing technology to detect the gene structure mutation, including single base mutation, mRNA (messenger ribonucleic acid) deletion or increase, mRNA structure transversion and mRNA splicing change.
Owner:GENESEEQ TECH INC

Sheep disease resistance related molecular marker of ISG15 gene and application thereof

The invention relates to a sheep disease resistance related molecular marker of ISG15 gene and application thereof. A sheep disease resistance related gene segment applied as a molecular marker is obtained through cloning from sheep ISG15 gene, and the nucleotide sequence is shown in SEQ ID NO: 1 in the sequence table; and the gene has a base transversion of A235-C235 at the SEQ ID NO: 1. The sheep disease resistance related molecular marker of ISG15 gene has the following beneficial effect that three gene types of wild isozygoty AA, mutation heterozygosity AC and mutation isozygoty CC are discovered in the hu-sheep flock. The invention also discloses a primer for amplifying the intron region of the ISG15 gene part and a detection method for the molecular marker. The invention provides a new molecular marker for marker assisted-selection of the sheep.
Owner:ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES

6-cyano-1,1(1,3-subpropyldioxy)-7-[1'-(carbalkoxy)-propyl]-5-oxo-delta6(8)-tetrahydro indolizine compound preparation method

The invention belongs to organic chemistry field, which in detail relates to a process of preparing 6- cyano-1, 1 (1, 3- dioxypropylidene)-7- [1' (alkoxycarbonyl)- propyl ]- 5- oxo-Delt6 (8)- tetrahydrochysene indolizine (I). The 6- cyano-1, 1 (1, 3- dioxypropylidene)-7- [ (carbomethoxyl group)- methyl ]- 5- oxo-Delt6 (8)- tetrahydrochysene indolizine (II) and haloethane reacts with each other for ethylization with existence of alkali and organic solution with or without phase transversion catalyst, and produces mentioned product. The invention is characterized by temperatate reaction condition, easy operation, low cost, high-purity product and suitability for industrial production.
Owner:FUDAN UNIV

Bovine CAST gene SNP and meat tenderness

The present invention relates to the identification of a single nucleotide polymorphism (SNP) within the bovine CAST locus encoding the calpastatin protein, wherein the allelic variation of the SNP is a G / C transversion associated with post-mortem muscle tenderness. The invention further relates to oligonucleotides useful in identifying the genotype of bovines as it relates to the CAST locus polymorphic site. The invention also encompasses computer-assisted methods and systems for improving the production efficiency for livestock having marketably tender meat using multiple data, and in particular the genotype of the animals as it relates to the CAST SNP. These methods of the invention encompass obtaining a genetic sample from each animal in a herd of livestock, determining the genotype of each animal with respect to specific quality traits as defined by a panel of at least two single polynucleotide polymorphisms (SNPs), one SNP corresponding to a site between exons 5 and 6 of the bovine CAST locus, grouping animals with like genotypes, and optionally, further sub-grouping animals based on like phenotypes.
Owner:UNIVERSITY OF GUELPH

Preparation method of gradient polymer optical fiber premade rod

A process for preparing the prefabricated gradient optical fiber rod from polymer includes such steps as adding trigger and chain transferring agent to high-purity methyl methylacrylate, prepolymerizing until the transversion rate is 8-20%, adding it in a stainless steel container or glass tube with one closed end, high-speed rotating to obtain a methyl polymethylacrylate layer on inner surface, adding trigger, chain transferring agent and doping agent to another high-purity methyl methylacrylate, and continuously repeating said steps. Its advantages are large size and controllable refractivity curve.
Owner:XI AN JIAOTONG UNIV

CaCl2 induced soybean pollen tube channel gene transfer method

The invention discloses a transgenic method for soybean tube pollen tube channel induced by CaCl2, and it is used for field of biotechnology and modern agricultural technique. The method comprises following steps: preparing DNA solution, adding CaCl2 solution to produce DNA solution containing inducer CaCl2, selecting flower bulbs and time for tranversion, inducing soybean tube pollen tube channel to transverse into soybean with said CaCl2- containing DNA solution, and managing. The CaCl2- containing DNA solution includes target gene, and the DNA damage is reduced; CaCl2 of proper concentration can induce pollen tube to extend and grow, increase rate of outer gene entering into ovary, the gradient of calcium ion aslo accelerates the speed of outer gene into ovary. The transversion rate isincreased by 1- 2 times in this invention comparing with current pollen tube channel.
Owner:SHANGHAI JIAOTONG UNIV

Molecular marker for identifying sphyraena pinguis gunther from sphyraena putnamae and application of molecular marker

The invention aims to provide molecular marker for identifying sphyraena pinguis gunther from sphyraena putnamae and an application of the molecular marker to solve the problem that germplasms of sphyraena fishes are mixed. The molecular marker for identifying the sphyraena pinguis gunther from the sphyraena putnamae comprises a primer F and a primer R respectively, wherein primer sequences are asfollows: the primer F: TCAACCAACCACAAAGACATT; the primer R: ATTATTAGGGGGATGAGTCAGTT; and the molecular marking primers are applied to identification of the sphyraena pinguis gunther from the sphyraena putnamae. Results of the molecular marking sequences indicate that the two fishes have difference of 35 basic groups including 25 conversions and 10 transversions, the results are stable and the repeatability is high. The method is simple to operate, easy to master and high in accuracy.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Dna probe library for hybridization with bcr or abl gene and method for enriching bcr-abl gene fragments using it

The invention provides a DNA (Deoxyribonucleic Nucleic Acid) probe library for hybridization with a BCR or ABL gene and a method for enriching BCR-ABL gene segments. The DNA probe library comprises one or more DNA probes capable of being hybridized with the BCR or ABL genes. The invention also provides a method for enriching BCR-ABL gene segments by using the DNA probes. On this basis, the invention also provides a method for detecting whether the mutation of the BCR-ABL gene or the gene structure thereof exists. The method provided by the invention is capable of obtaining the gene segments through enrichment by thousands of times; the method can be applied to the next generation sequencing technology to detect whether the mutation of the BCR-ABL gene or the gene structure thereof exists, including single base mutation, mRNA (messenger Ribose Nucleic Acid) deletion or amplification, mRNA structure transversion and mRNA splicing change.
Owner:NANJING SHIHE MEDICAL DEVICES CO LTD

DNA probe library for hybridizing with kras gene and method for enriching kras gene fragments using the same

The invention provides a DNA (Deoxyribonucleic Acid) probe library used for hybridization with a KRAS gene. The DNA probe library comprises one or more DNA probes which can be hybridized with the KRAS gene, wherein the DNA probes include the following sequences: SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9 or SEQ ID NO. 10. The invention further provides a method for enriching the KRAS gene segments by adopting the DNA probe library. Based on this, the invention further provides a method for detecting gene structure mutations of the KRAS gene. The method disclosed by the invention can be adopted to obtain the KRAS gene segments by enriching in thousands of times, and the KRAS gene segments can be used for a next generation sequencing technology to detect the gene structure mutations including single base mutation, mRNA deletion or increase, mRNA structure transversion and mRNA splicing change.
Owner:GENESEEQ TECH INC

PML-RARA fusion gene mutation detection method

According to the PML-RARA fusion gene mutation detection method provided by the invention, the change condition of the PML and RARA fusion gene can be accurately detected through a next generation sequencing (NGS) technology, and the method provided by the invention can be used for synchronously detecting various gene variation types such as gene mutation, deletion, increase, transversion and the like; the kit can be used for comprehensively guiding the diagnosis of clinical acute promyelocytic leukemia (APL), and guiding the subsequent treatment and drug resistance selection of an arsenical agent or all-transretinoic acid (ATRA), and can be used for comprehensively guiding the clinical diagnosis of the APL and guiding the subsequent treatment and drug resistance selection of the arsenical agent or all-transretinoic acid (ATRA).
Owner:GENESEEQ TECH INC +1

Large yellow croaker mitochondrial molecule mark and its use in identification for cultivated population and wild population

The present invention relates to identification between cultivated population and wild population of large yellow croaker, and mitochondrial molecule mark for identification between cultivated population and wild population of large yellow croaker has difference of four bases, including one transversion and three transformatiions. The identification process includes the steps of: designing and synthesizing one pair of conservative primers L14841, 5'-CCATCCAACATCTCAGCATGATGAAA-3' and H15149, 5'-GCCCCTCAGAATGATATTTGTCCTCA-3'; PCR amplification of cytochrome gene B(cyt b) in the mitochondrial DNA of both cultivated population and wild population; purification of amplification result; and sequencing and comparing the sequencing result. The identification method is simple.
Owner:XIAMEN UNIV

CaCl2 induced soybean pollen tube channel gene transfer method

The invention discloses a transgenic method for soybean tube pollen tube channel induced by CaCl2, and it is used for field of biotechnology and modern agricultural technique. The method comprises following steps: preparing DNA solution, adding CaCl2 solution to produce DNA solution containing inducer CaCl2, selecting flower bulbs and time for tranversion, inducing soybean tube pollen tube channel to transverse into soybean with said CaCl2- containing DNA solution, and managing. The CaCl2- containing DNA solution includes target gene, and the DNA damage is reduced; CaCl2 of proper concentration can induce pollen tube to extend and grow, increase rate of outer gene entering into ovary, the gradient of calcium ion aslo accelerates the speed of outer gene into ovary. The transversion rate is increased by 1- 2 times in this invention comparing with current pollen tube channel.
Owner:SHANGHAI JIAO TONG UNIV

Mutation in the rat adenomatous polyposis coli gene within the human mutation hotspot region

InactiveUS7897834B2Sugar derivativesPeptidesCarcinogenAdenomatous polyposis coli
A rat with a disrupted Apc (adenomatous polyposis coli) gene is provided. The mutation can include an A to T transversion changing a lysine to a stop codon at codon 1137. Methods of generating the knockout rat are provided. Also provided is the offspring or progeny of that rat. In addition, methods of using these rats are provided, including methods for screening a carcinogen or a promoter of carcinogenesis, and methods for screening preventive and inhibitory agents of carcinogenesis.
Owner:WISCONSIN ALUMNI RES FOUND

Memory system data arrangement and commutation method

InactiveCN100535846CReduce the cost of distribution transformationImprove performanceInput/output to record carriersComputer architectureDisk array
The invention discloses a data distribution and mutual conversion method of a storage system. A continuous storage space is formed by a plurality of disks, the disks also form a disk array by strips to partition the disk array into continuous storage subspaces, namely sub array, and then redundancy level can be respectively configured as zero, one, or five according to requirements; during conversion, corresponding modes are selected according to differences of transversion types. The invention has the major concept of adopting suitable data distribution mode for I / O requirements with different inquiry characteristics according to partial characteristic of I / O requirements, thereby enabling the storage system to realize optimal performance. The storage system data distribution conversion method disclosed by the invention facilitates the system being dynamically suitable for changes of I / O requirement characteristic, reduces cost caused by data distribution conversion among different redundancy levels and eliminates performance bottleneck generated by data transfer, thereby greatly improving performance of storage subsystem.
Owner:HUAZHONG UNIV OF SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More