Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

GRA17 gene deleted toxoplasma gondii attenuative mutant strain and preparation method thereof

A gene deletion and Toxoplasma gondii technology, applied in the field of Toxoplasma gondii attenuated mutant strains and its preparation, can solve the problem of limited application

Inactive Publication Date: 2017-07-21
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the only live attenuated Toxoplasma gondii vaccine available in the world is S48, but it is limited to the application of goats and sheep

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GRA17 gene deleted toxoplasma gondii attenuative mutant strain and preparation method thereof
  • GRA17 gene deleted toxoplasma gondii attenuative mutant strain and preparation method thereof
  • GRA17 gene deleted toxoplasma gondii attenuative mutant strain and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] A Toxoplasma gondii attenuated mutant strain with GRA17 gene deletion. The toxoplasma gondii attenuated mutant strain with GRA17 gene deletion is LZ△GRA17, which is preserved in China Center for Type Culture Collection with the preservation number CCTCC NO: V201656.

[0038] The preparation method of the toxoplasma gondii attenuated mutant strain of above-mentioned GRA17 gene deletion, such as figure 1 shown, including the following steps:

[0039] 1. Construction of pSAG1::Cas9-U6::sg GRA17 plasmid:

[0040] 1. Use web software to design the sgRNA of GRA17 as GACTGTCCCTGAGGACCCAT.

[0041] 2. Use the Q5 site-directed mutagenesis kit (NEB) and amplification primers (gRNA-Fw: GACTGTCCCTGAGGACCCATG TTTTAGAGCTAGAAATAGC and gRNA-Rv: AACTTGACATCCCCATTTAC) to replace sgUPRT in pSAG1::Cas9-U6::sgUPRT vector with sgRNA of GRA17 to construct pSAG1: :Cas9-U6::sgGRA17.

[0042] 3. The PCR conditions are: using pSAG1::Cas9-U6::sgUPRT as a template, using primers gRNA-Fw and gRN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a GRA17 gene deleted toxoplasma gondii attenuative mutant strain. The GRA17 gene deleted toxoplasma gondii attenuative mutant strain is LZdeltaGRA17, which is preserved in China Center for Type Culture Collection with a preservation number of CCTCC NO:V201656. The invention also provides a preparation method of the strain. According to the invention, the GRA17 gene deleted toxoplasma gondii attenuative mutant strain provided by the invention is established on a molecular biology basis, and is a gene deleted insect strain constructed based on the CRISPR / Cas9 gene knockout technology, the insect strain has attenuated toxicity, also loses the biological characteristic of lethality to mice, has enormous application value, and can be used as a candidate strain of attenuated live vaccines.

Description

technical field [0001] The invention relates to the technical field of attenuated toxoplasma gondii strains, in particular to an attenuated toxoplasma gondii mutant strain with GRA17 gene deletion and a preparation method thereof. Background technique [0002] Toxoplasmosis is a zoonotic parasitic disease caused by Toxoplasma gondii. About one-third of the world's population is infected by it. Toxoplasma can infect almost all warm-blooded animals. It is highly contagious, has a wide range of epidemics, and has a wide host spectrum. Currently, there is no vaccine available, so it is extremely difficult to prevent and control the disease , the requirements for prevention and control technology are very high. In view of the limited ability of drugs to treat toxoplasmosis and the characteristics of high toxicity and side effects, the development of its vaccine has gradually become an imperative task for the prevention and control of toxoplasmosis. At present, the types of anti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/11C12N15/79C12N15/87
CPCC07K14/45C12N15/79C12N15/87C12N2810/10
Inventor 王金磊黄思扬陈凯侯俊玲李法财宋慧群朱兴全
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com