83results about How to "Achieve the effect of increasing production" patented technology

The invention relates to a flue-cured tobacco cultivation method resisting spring drought. The method comprises the steps that variety distribution is reasonably planned; ditching and ridging are carried out, and a two-row concave ridge which is 200-240cm in width and 20-25cm in height is implemented; for transplantation, seedlings are transplanted early in good time, transplantation is generally finished during the period from the end of March to the middle ten days of April, the method of a well cellar with the diameter of 8-9cm and the depth of 16-20cm is adopted, and a shovel is utilized for marking out a concave furrow which is 8-10cm in width and 2-3cm in depth on the ridge, so that the well cellar is dug easily, and water is prevented from being wasted; fertilizer is applied according to the equal nitrogen principle, and 30-50% of organic nitrogenous fertilizer is additionally applied to soil for the second time; film mulching is carried out, a film is uniformly compacted through soil in a line-shaped mode, and a gap between the surface of the soil and the film is 0.5-1cm. The method simple and easy to implement is adopted for carrying out flue-cured tobacco cultivation, harm to growth and development of flue-cured tobaccos due to the drought can be reduced, an effective yield increase way is provided for tobacco-growing areas suffering from the drought, the output value is increased, and the economic benefit is increased.

The invention discloses a rice soilless seedling raising nutrition matrix. The formula of the matrix comprises an original matrix with turf and vermiculite mixed according to the volume ratio of 3 : 1. The rice soilless seedling raising nutrition matrix is characterized in that 3.5 kg-4.5 kg of potassium chloride compound fertilizer, 10 g-15 g of fulvic acid, 8 kg-10 kg of zeolite powder adsorbents, 8 g-10 g of chitin and 10 g of silicon fertilizer are added into each cubic meter of original matrix and are evenly mixed. The rice soilless seedling raising nutrition matrix can meet the requirement of whole rice seedling stage growing and developing, extra nutrient solutions do not need to be poured, and the matrix has multiple effects of nutrition, drought resisting and disease resisting and is suitable for promotion and application.

The invention discloses a method for treating iron-containing dust in an iron and steel plant by using a cupola furnace, belonging to the technical field of iron making. The method is characterized by comprising the following steps of: blending, uniformly mixing, briquetting and maintaining raw materials including dust in the iron and steel plant, a carbonaceous reducing agent, a bonder and an additive, and then putting the raw materials into the cupola furnace for iron making, wherein the carbon content of carbon-containing pellets prepared by briquetting raw materials of various iron-containing dust in the iron and steel plant is about 10%, the compressive strength of the maintained pellets is greater than 1000N per each pellet, and the pellets are distributed into the cupola furnace for iron making through a material distribution system; and preheating blast through a hot blast furnace, preheating the wind temperature from a normal temperature to about 500-1200 DEG C, and enriching oxygen by 1-5% in the blast to achieve the aims of improving the smelting strength, increasing the output and reducing the coke ratio. By adopting the method, the dust of the iron and steel plant can be recycled to achieve the aims of saving energy, reducing emission and reducing environmental pollution, so that the method has good economic and social benefits.

The invention belongs to the technical field of biology, and discloses development and application of a molecular marker for controlling corn hundred-grain weight and grain length character compact interlocking. A primer designed according to the molecular marker is L1-F:GCCGGAGTGAGCTGGCAGAA and L1-R:GGGAACGGCGAGATATTTTG. The inventor identifies and develops the molecular marker for corn hundred-grain weight and grain length character compact interlocking. The molecular marker has the potential breeding value. Molecular breeding auxiliary selection is performed through the marker, the corn hundred-grain weight and grain length yield character can be remarkably increased, and therefore the yield increase effect is achieved. The molecular marker can be used for molecular marker auxiliary selection and breeding.

The invention relates to a straw mushroom culture medium and a straw mushroom culture method, belonging to the field of edible fungi cultivation. The straw mushroom culture medium disclosed by the invention comprises two formulae, one of which comprises dry straws, bran, rice bran, mulberry branches, cannabis sticks, soybean meal, white sugar and cannabis bran while the other of two formulae comprises the following raw materials by weight: dry straws, rice bran, corn flour, gypsum powder, mulberry branches, cannabis sticks, soybean meal, white sugar and cannabis bran. The formulae further comprise whitewash. By introducing the raw materials such as straws, mulberry branches, cannabis sticks, soybean meal, white sugar and cannabis bran in the ingredients of the culture medium provided by the invention, waste resources such as straws, mulberry branches, cannabis sticks and cannabis bran are prevented from being wasted and are used as the raw materials for cultivating straw mushrooms, so that the resources are fully utilized, the production cost is lowered, and the economic income of rice growers, sugarcane grower and the like are increased.

The invention relates to a microorganism bacterial fertilizer and a preparation method thereof. The microorganism bacterial fertilizer is prepared by the following raw materials in percentage by weight: 1 to 4 parts of photosynthetic bacterium stock solution, 15 to 20 parts of vinegar, 6 to 8 parts of allicin, 1 to 3 parts of capsaicine and 1 to 3 parts of tobacco plant stem. By the fertilizer and the preparation method, the fertilizer efficiency and the utilization rate of the photosynthetic bacterium stock solution are improved. The microorganism bacterial fertilizer does not contain any chemical pesticide component and does not have toxic and side effects; and the prepared fertilizer can prevent and control multiple diseases of crops, has a leading effect of beneficial bacteria, and can control and kill harmful bacteria to achieve the effect of increasing yield.

The invention provides an expansion composite perforating gun, and belongs to the technical field of oilfield exploration and development. The expansion composite perforating gun eliminates serious formation contamination, improves the perfection degree of perforation and increases oil gas well capacity. According to the technical scheme, the expansion composite perforating gun is composed of a gun carrier, an inner and outer blind hole gun body, an expansion and efficacy-improving gunpowder box and a perforating bullet. The expansion and efficacy-improving gunpowder box is mounted at the front end of the perforating bullet, after a perforator detonates a penetrating hole, gunpowder is combusted, high-energy particle carrier waves and high-energy impact waves generated by the gunpowder are expanded and are used for acting on a perforated tunnel within microsecond time, the perforated tunnel is extended and expanded, and therefore the purpose of perforated tunnel expansion is achieved. The perforating depth and the pressed crack length can be beyond the range of a pollution zone, so that the penetrating quality of the immediate vicinity of a wellbore is improved, and the flow conductivity of a stratum is improved.

The invention discloses a soil conditioner for increasing content of humus in red-yellow muddy field soil in southern double-cropping rice regions. The soil conditioner is prepared from decomposed organic fertilizer, compound fertilizer, humus, biomass charcoal and a composite microbial agent. The soil conditioner provided by the invention contains the beneficial components such as the organic fertilizer, the biomass charcoal, the humus and the microbial agent, wherein the organic fertilizer, the biomass charcoal and the humus help to improve the soil structure, reduce soil bulk density and enhance soil permeability; the humus is rich in organic carbon content, thus being capable of supplementing the organic matter content in the soil; the organic carbon in the humus has homology with thebiomass carbon, so that the content of the soil humus can be increased after the humus and the biomass carbon are applied at the same time; the composite microbial agent is beneficial to promotion ofsoil microbial activity and nutrient release as well as enhancement of soil nutrient supply; after being applied, the soil conditioner helps to alleviate soil hardening of the red-yellow muddy field in the southern double-cropping rice regions, improve the soil environment, increase the soil humus content, fertilize the soil and promote rice growth, thus achieving the effect of increasing rice yield.

The invention discloses a Chinese herbal medicine control agent for grape diseases and a preparation method of the control agent and belongs to the technical field of Chinese herbal medicine pesticides. The Chinese herbal medicine control agent is prepared from raw materials as follows: 5-8 parts of fructus nandinae domesticate, 5-8 parts of sheaths of sugarcane, 50-80 parts of baijiu, 1-5 parts of fructus rubi, 2-6 parts of ground ivy, 3-6 parts of lychee seeds, 3-6 parts of semen arecae, 4-7 parts of Chinese ilex, 3-8 parts of orange leaves, 2-7 parts of lycoris radiate, 2-6 parts of hemp leaves, 3-8 parts of mint leaves, 1-3 parts of cassia twigs, 2-6 parts of herba lysimachiae, 3-7 parts of houttuynia cordata, 1-5 parts of herbs of spanishneedles, 2-5 parts of perilla frutescens, 3-5 parts of herba lophatheri, 2-5 parts of leaves of zingiber officinale, 1-3 parts of peach twigs, 2-8 parts of cotton seeds, 3-5 parts of herba portulacae and 2-5 parts of peony. The preparation method of the control agent comprises raw material treatment, extraction, spray drying, drying and packaging. The raw materials of the Chinese herbal medicine control agent for grape diseases are all natural materials, are non-toxic, have no residues and are harmless; the production method of the Chinese herbal medicine control agent is simple, easy to operate, low in production cost and convenient to use.

The invention discloses a wheat straw biochar fertilizer capable of increasing yield and income and a preparation method thereof. The wheat straw biochar fertilizer is prepared from the following raw materials in parts by weight: 37-43 parts of corn cob granule, 22-26 parts of traditional Chinese medicine residue, 3-5 parts of sodium nitrate, 2-4 parts of sodium chloride, 3-4 parts of calcium bicarbonate, 28-32 parts of beanpod shell powder, 2-3 parts of disodium edetate, 110-130 parts of fresh Enteromorpha, 4-5 parts of composite microbial inoculant, 190-210 parts of wheat straw, 24-28 parts of fresh urine and a right amount of water. Abundant biomass, quick-acting nutrients, microbes and other components are added on the basis of the straw carbon powder; the quick-acting nutrients and biomass can provide long-term nutrient supply for crops under the combined actions; the biochar surface can be used as a habitat of the composite microbes, thereby being beneficial to growth of the microbial florae; and the carbon dioxide released by respiration can enhance the concentration of carbon dioxide near the crops, thereby promoting the photosynthesis of crops and achieving the effect of increasing the crop yield.

The invention provides a saline-alkali soil conditioner which is characterized by comprising sodium polyacrylate, ion exchange resin, biogas residues and a microbial agent. The biogas residues are used in the saline-alkali soil conditioner, so that waste resources are sufficiently utilized, waste materials are changed into things of value, and furthermore the raw materials are low in cost and available; and due to the addition of ion exchange resin, relatively-high-content sodium ions in saline-alkali soil can be adsorbed, and the structure and pH value of the soil can be regulated, so that the saline-alkali soil conditioner is beneficial to plant growth.

The invention relates to a single driving synchromesh corrugated-surface roller press which is used for smashing material, wherein the driving synchromesh corrugated-surface roller press comprises a main rack; two dentate extruding rollers, which is arranged on the main rack, wherein one of the rollers is a corrugated fixed roller, the other is a corrugated movable roller, the extrusion surfaces of the corrugated fixed roller and the corrugated movable roller are respectively provided with a multiple of mutually matched corrugated fixed roller grinding units and corrugated movable roller grinding units, a material extruding channel is formed between the corrugated fixed roller grinding units and the corrugated movable roller grinding units, and material enters the material extruding channel to perform extruding; a dual-output synchronous reduction gear, which is connected with the two dentate extruding rollers; and a motor, which is connected with the dual-output synchronous reductiongear, wherein the motor controls the two dentate extruding rollers to synchronously rotate by the dual-output synchronous reduction gear. The single driving synchromesh corrugated-surface roller presseffectively avoids abrasion of the roller surface caused by relative sliding due to unequal linear velocity of the roller surfaces of the dentate extruding rollers and reduces the energy consumption,and the powder selecting efficiency is promoted.

The invention discloses a Chinese herbal medicine preventing and controlling agent for crop root diseases and insect pests and a preparation method thereof, and belongs to the technical field of Chinese herbal medicine pesticides. The Chinese herbal medicine preventing and controlling agent comprises the raw materials in parts by weight: 3-8 parts of betel nut, 2-8 parts of banyan, 3-8 parts of rabbit dung, 2-5 parts of maple, 3-6 parts of fructus amomi, 2-5 parts of lime, 3-6 parts of pomegranate, 1-2 parts of sulfur, 1-3 parts of hemp leaves, 2-5 parts of konjac, 3-5 parts of hawthorn leaves, 3-6 parts of star anise, 2-3 parts of zanthoxylum piperitum, 1-3 parts of parthenocissus tricuspidata, 1-3 parts of bidens pilosa, 2-5 parts of lily, 2-5 parts of raspberry, 2-8 parts of cotton seeds and 3-7 parts of semen litchi. The preparation method comprises the steps of raw material treatment, extraction, spray drying, drying and packaging. The raw materials of the Chinese herbal medicine preventing and controlling agent are natural materials, so the Chinese herbal medicine preventing and controlling agent has the advantages of non-toxic ingredients, no residues and no environmental pollution; and moreover, the Chinese herbal medicine preventing and controlling agent has the advantages of simple production method, easy operation, low production cost and convenience in use.

The invention belongs to the biotechnical field and discloses a molecular marker primer for controlling a QTL locus of corn ear length and an application. The applicant identifies a novel main effectQTL ZmEL-1 for controlling corn ear length. The main effect QTL ZmEL-1 is positioned on a long arm of a first chromosome and is located between markers 1.10-131 and 1.10-91. The physical section is chr1:2799925380-283401913. The main effect QTL of controlling the ear length is found in the section for the first time and relatively high phenotype rate of contribution and additive effect exist, so that the primer has a potential breeding value. The locus can enhance the capacity characters such as ear length, row grain quantity, ear weight and ear grain weight obviously so as to achieve the effect of increasing the output. The developed molecular marker interlocked tightly with the QTL ZmEL-1 can be used for marker-assisted selection breeding.

The invention discloses efficient yield-increasing biological bacterial fertilizer. The formula of the efficient yield-increasing biological bacterial fertilizer consists of the following raw materials in parts by weight: 30 to 40 parts of organic matter, 30 to 40 parts of cultivating soil, 10 to 12 parts of pure water mixture, 4 to 6 parts of actinomycetes, 3 to 5 parts of nitrogen-fixing bacteria, 6 to 8 parts of silicate bacteria, 2 to 3 parts of bacillus subtilis, 3 to 5 parts of paenibacillus polymyxa, 5 to 7 parts of trichoderma viride, 5 to 7 parts of saccharomycetes and 1 to 3 parts of photosynthetic bacteria. Fermentation is conducted on the basis of the traditional organic fertilizer to form the organic matters, neutralized buffering is conducted through high-quality black soil, the organic matters are dispersed into the black soil, chemical fertilizer is added into the pure water mixture, the action effect of the fertilizer is improved by the high-fertility effect of the low-concentration chemical fertilizer, the fertility of the bacterial fertilizer can be guaranteed, the passivated nutritional components in the soil can be released through the decomposition action of the microbial bacteria and then are completely utilized by crops, and the yield increasing effect is achieved; furthermore, nitrogen fixation is conducted by utilizing the absorption and dissimilation effect of the microorganisms well, so the soil fertility is improved and remained.

The invention relates to a preparation method of a high-efficiency environment-friendly seedling culture substrate, and belongs to the technical field of seedling culture materials. According to the method, straws and fresh cow dung are used as raw materials, and a low-temperature pyrolysis bio-carbon preparation technology is adopted to prepare the bio-carbon, so that the bio-carbon has an obvious carbon fixing effect and a promoting effect on soil fertilizer efficiency; the prepared bio-carbon has a rough surface, presents an uneven and honeycomb structure, has a developed hole structure with different hole diameters on the surface, and a part of carbon atoms form a stable lamellar graphite structure, so that the properties of the bio-carbon in application are kept relatively stable; thebio-carbon prepared by mixing the straws and the cow dung can prevent the pollution to the environment, has a good adsorption effect, and has the effect of water storage and fertilizer on the soil; according to the preparation method of the high-efficiency environment-friendly seedling culture substrate, penicillium and prepared bio-carbon are combined, high-efficiency and environment-friendly seedling culture substrate is prepared to promote the function of rhizosphere colonization and post-emergence growth promoting function of functional strains; the substrate has the advantages of high efficiency, broad spectrum, long-term, safety, no pollution and no residue.

The invention discloses a method for controlling bottom water channeling by using a gas water locking effect. The method is mainly suitable for potential tapping of remaining oil of a dwarf oil reservoir. According to the method for controlling bottom water channeling by using the gas water locking effect, nitrogen foam is injected into a stratum at high pressure and large displacement, the pressure of a near-wellbore area is rapidly increased, the injected foam can make up for pressure deficit of a near-wellbore zone, the pressure of the stratum is increased, and the energy of a reservoir isrecovered; and by using the strong oil-water selective plugging effect and Jamin effect of the nitrogen foam, a water cone can be pressed to move downwards, a bottom water channeling channel is effectively plugged, and bottom crude oil is displaced to move upwards to a wellbore to be extracted. Bottom water channeling is effectively controlled, the remaining oil of the reservoir is pushed to the near wellbore through the pressure and the water locking effect generated in the injection process, and the purposes of improving the oil well yield and recovery efficiency of a dwarf oil well and effectively tapping the remaining oil in a potential layer are achieved.

The invention relates to the technical field of fruit tree planting, in particular to a method for improving planting yield of golden plum. The method comprises nine management steps of planting landselection and treatment, fruit tree pruning, plantation secondary treatment, a fruit tree digging, fruit tree transplanting, fertilizer and water management, planting management, pest control and shaping and pruning; an existing golden plum orchard in a high-yield period is selected as a female parent, over dense fruit trees are dug and transplanted, the planting distance between every two existing golden plum trees after being transplanted is controlled to be 3.5-4 meters, thereby effectively increasing interspace among the existing golden plum trees and increasing the ventilation rate and sunlight permeability among the fruit trees, the effect of increasing the yield is achieved while the number of fruit trees is reduced, the quality of the golden plum is improved, and the planting and management cost of the existing golden plum orchard is reduced; through cooperating of a mature golden plum tree transplanting technology, the survival rate of fruit tree transplanting is effectively improved, the growth advantages of the fruit trees are increased, and the fruit bearing cycle of transplanted fruit trees is shortened.

The invention relates to a light-transforming transparent plastic greenhouse film for cucumber planting, and a preparation method thereof. The preparation method comprises the following steps: a, taking a benzoxazole compound, adding N-methyl-2-pyrrolidone phosphate dihydrogen phosphate and hydrogen peroxide and performing oxidative desulfurization to obtain oxygen-substituted sulfur-free benzoxazole compound; b, adding rare earth metal ions into the oxygen-substituted sulfur-free benzoxazole compound and performing coordination to prepare a composite light-transforming agent; c, mixing the composite light-transforming agent, matrix resin, filler, a surfactant and a light stabilizer and performing extrusion and blow molding to obtain a transparent greenhouse film; and d, performing coronatreatment and hot-press molding on the transparent greenhouse film to obtain the light-transforming transparent greenhouse film. The light-transforming transparent plastic greenhouse film for cucumberplanting can increase yellow light, red light and orange light, eliminate green light and purple light, promote budding and flowering of the cucumbers, achieve the yield increasing effect, increase the utilization rate of sunlight, prolong the service life of the greenhouse film and effectively delay the ageing speed of the greenhouse film.

The invention relates to a method for processing a culture medium of edible fungi. The method comprises the steps: airing crop straw, pulverizing the aired crop straw with a pulverizer so as to obtainpulverized straw with a length of 1 cm, mixing fresh potato residues with a water content of 80% with the pulverized crop straw at a mass ratio of (3-5):(7-5) in term of dry weight, adding 2% of gypsum or calcium carbonate and 0.1% of carbendazol powder or 0.1% of thiophanate-methyl and other fungicides, performing even stirring in a stirrer, adding lime water so as to adjust the pH value of themixed materials to 6-8, and pouring the mixed materials obtained in the two steps into polypropylene plastic bags with the specification of 17 cm X 35 cm X 0.045 cm in a mechanical or manual bagging mode, wherein the bag height is about 17-23 cm; and performing sterilization at normal temperature and normal pressure for 8-12 hours or autoclaved sterilization for 2-3 hours. The culture medium is applied to cultivation and production of edible fungi, comprehensive utilization of the potato residues and crop straw is achieved, and both solution of the problem of potato residue treatment and supply of a culture medium for producing high-quality edible fungi are achieved.

The invention belongs to the field of biological agents, and particularly relates to a biological agent capable of enhancing the pesticide efficacy and improving leaf functionality and application ofthe biological agent. Aiming at solving the problems that the pesticide efficacy of an existing biological agent is generally low, the pest and disease damage resisting capability of crop leaves cannot be improved, the growth of crops is affected, and consequently the crop yield is low, the following scheme is proposed, specifically, the biological agent is prepared from the following raw materials in parts by weight: 15-21 parts of a thunder godvine extracting solution, 2-7 parts of glucose, 5-10 parts of amino acid, 4-11 parts of aloe powder, 1-6 parts of lemon seed powder, 10-16 parts of urea, 1-4 parts of monopotassium phosphate, 3-8 parts of wormwood, 4-8 parts of ethephon, and 2-7 parts of cyclanilide. According to the biological agent, the pesticide efficacy is enhanced, so that thepest and disease damage resisting capability of the crop leaves is significantly enhanced, meanwhile, nutritional components required by the growth of the crop leaves are provided, the growth of thecrop leaves is stimulated, the quality of agricultural products is improved, the yield increasing effect is finally achieved, and a preparation method is simple.

The invention provides hardening-preventing microorganism coated fertilizer. The hardening-preventing microorganism coated fertilizer comprises a hardening preventing agent, compound fertilizer and a coating agent; the weight ratio of the hardening preventing agent, the compound fertilizer and the coating agent is (20 to 50) to (2000 to 4000) to (40 to 80); the hardening preventing agent comprises hardening preventing oil, carbon powder, urea and potassium humate; the coating agent comprises feather protein powder, mountain flour and fungicide and is used for improving disease resistance of crops and the yield of crops.

The invention relates to the technical field of agriculture, and particularly relates to a preparation and using method of a yield increasing agent for sowing and stirring morchella esculenta strain.The method can increase nutrition, is convenient and simple to use, and has an obvious effect, and can obviously promote the mycelium germination, mycelia fast occupy a material surface, and the mycelium amount is increased, so that the effect of increasing the yield is achieved. The method comprises the following steps: 1) preparing the yield increasing agent for sowing and stirring morchella esculenta strain, wherein the yield increasing agent comprises the following components: 20g of dipotassium hydrogen phosphate, 10g of magnesium sulfate, 30g of yeast extract and 940g of oil-tea camelliaseed cake; and 2) preparing the yield increasing agent for sowing and stirring morchella esculenta strain, weighing dipotassium hydrogen phosphate, magnesium sulfate and yeast extract according to the proportion in the step 1), crushing the oil-tea camellia seed cake into fine particles, adding distilled water, adjusting the water content to 60%, and adjusting the pH value to 7.0.

The invention relates to applications of a fulvic acid composition in paddy field weed prevention and control and paddy rice yield increasing. The fulvic acid composition comprises potassium fulvic acid, an amino acid, film coated urea, and nicotine at a weight ratio of 6-8:1-3:0.5-2:0.05-0.1. The fulvic acid composition possesses nutrient adjusting effect, is capable of preventing and controllinggramineous weeds and broadleaf weeds, and increasing paddy rice yield at the same time.

The invention discloses a traditional Chinese medicinal preparation of preventing Pearl plum common diseases and a preparation method thereof, and belongs to the technical field of traditional Chinese medicinal pesticides. The raw materials comprise 3-8 parts of lily, 2-7 parts of Corter Pseudolaricis, 3-6 parts of cortex lycii radicis, 2-5 parts of rhizoma polygonati, 1-4 parts of poria cocos, 1-4 parts of radix ophiopogonis, 2-7 parts of lychee seed, 3-6 parts of rabbit dung, 2-8 parts of Nandina domestica Thunb, 1-4 parts of pyrrosia lingua, 1-3 parts of lotus leaf, 2-6 parts of myrrh, 1-3 parts of pinellia ternata, 2-4 parts of lysimachia christinae hance, 2-8 parts of hemp fimble leaf, 2-6 parts of lime, 2-7 parts of fructus amomi, 3-7 parts of chufa plant, 2-6 parts of lysimachia christinae hance and 1-4 parts of cortex fraxini. The preparation method comprises the steps of processing raw materials, extracting materials, spraying and drying, drying and packing. The raw materials of the traditional Chinese medicinal preparation of preventing Pearl plum common diseases are all natural materials which have no toxic components, no residues and no pollution. The preparation method of the traditional Chinese medicinal preparation of preventing Pearl plum common diseases has the advantages of being simple, easily operable, low in cost and convenient to use.

The invention relates to a fertilizer special for Camellia japonica and a preparation method thereof, and belongs to the technical field of fertilizers special for Camellia japonica. The fertilizer special for Camellia japonica comprises the following components in parts by weight: 80-100 parts of human and animal manure, 20-30 parts of weed and deciduous leaves, 15-20 parts of fungi residues, 15-20 parts of peanut shell, 5-10 parts of an extract product of Rosa laevigata, 5-10 parts of bitter gourd seeds, 15-20 parts of pumice, and 3-8 parts of a fertilizer starter. The fertilizer special for Camellia japonica has stable physical and chemical properties and balanced and comprehensive nutrition, after the fertilizer special for Camellia japonica is used, yield increase of Camellia japonica is about 20%; secondly, raw materials in the fertilizer special for Camellia japonica are selected from agricultural wastes with low cost and wide sources, and resources are recycled with economy and environmental protection; at the same time, the preparation method of the fertilizer special for Camellia japonica is easy to operate, convenient to operate, and easy to realize.

The present invention discloses a method for preparing a rice salt-tolerant special small molecule organic substance by using papermaking black liquid. The method comprises the following steps: (1) extracting and purifying organic substances in papermaking black liquid and separating the purified organic substances to obtain large molecular weight organic substances and small molecular weight organic substances; (2) modifying the small molecular weight organic substances and grafting reactive functional groups to obtain a first salt-tolerant small molecule organic substance; and (3) modifyingthe large molecular weight organic substances to lower molecular weight and increasing a phenolic hydroxyl group content to obtain a second salt-tolerant salt small molecule organic substance. The rice salt-tolerant special small molecule organic substance can soak seeds before direct seed sowing to improve a germination rate and rooting ability of the seeds, also can be used for seedling irrigation before rice seedling transplant to promote growth of rice roots and salt tolerance of seedlings, and can also be mixed with a fertilizer to be applied into soil together to achieve an effect of increasing production.

The invention relates to a method and a device for improving rock stratum fracturing and permeation enhancement based on fracturing fluid viscosity optimization, and belongs to the technical field of oil and gas wells. The method comprises the following steps: S1, selecting at least two fracturing fluids with different viscosities; s2, designing the injection time interval of the high fracturing fluid and the low fracturing fluid; s3, designing proper injection flows in different time periods; s4, fracturing fluids with different viscosities are alternately injected according to the parameters; and S5, continuously optimizing the fracturing process design according to the real-time monitoring data of fracturing. According to the method, a device comprises a high-viscosity fracturing fluid tank, a low-viscosity fracturing fluid tank and a fracturing fluid supply system, high-viscosity fracturing fluid is contained in the high-viscosity fracturing fluid tank, and low-viscosity fracturing fluid is contained in the low-viscosity fracturing fluid tank; the high-viscosity fracturing fluid and the low-viscosity fracturing fluid are intermittently injected into the shaft through the fracturing fluid supply system. According to the invention, the number and density of fractures generated in a rock stratum by a fracturing process can be improved, and a stronger permeation enhancing effect is achieved.

The invention discloses a light-converting transparent plastic greenhouse film for cucumber planting. The light-converting transparent plastic greenhouse film comprises the following components in parts by weight: 65-75 parts of low density polyethylene, 10-20 parts of calcium stearate, 5-10 parts of a titanate coupling agent, 10-12 parts of N-methyl-2-dihydrogen pyrrolidone phosphate, 20-30 partsof starch, 15-20 parts of polyvinyl alcohol, 10-20 parts of cotton fibers, 5-10 parts of glacial acetic acid, 5-10 parts of acetic anhydride, 3-5 parts of a plasticizer, 3-5 parts of a flexibilizer and 3-5 parts of a dispersing agent. The transparent plastic greenhouse film disclosed by the invention is capable of increasing yellow, red and orange light, eliminating green and purple light and promoting budding and flowering of cucumbers, and the effect of increasing yield is achieved, the utilization rate of sunlight is improved, the service life of the greenhouse film is prolonged, and the aging rate of the greenhouse film is effectively retarded.

The invention discloses multifunctional biological organic composite coated fertilizer. The multifunctional biological organic composite coated fertilizer is prepared from 65-69 parts by weight of rye bran, 56-59 parts by weight of rice saccharified slag, 35-40 parts by weight of mix-fired soya bean powder, 15-19 parts by weight of potassium chloride, 29-33 parts by weight of urea, 3-5 parts by weight of alum, 1-2 parts by weight of citric acid, 2-4 parts by weight of aluminum sulfate, 8-10 parts by weight of bamboo carbon powder, 2-3 parts by weight of starch ether, 2-4 parts by weight of fructus quisqualis powder, 22-25 parts by weight of diammonium phosphate, 5-7 parts by weight of an EM microbial inoculum, 3-4 parts by weight of neem bark powder, 7-9 parts by weight of a soil conditioner and a proper amount of water. The multifunctional biological organic composite coated fertilizer has a reasonable formula. Through use of the soil conditioner, effects of improving fertilizer effects and promoting nutrient absorption of plants are obtained. Through use of raw materials such as fructus quisqualis powder and neem bark powder, effects of expelling insects, killing insects, preventing insects, reducing or avoiding pesticide use and protecting the environment are obtained. Through use of the urea coating, the multifunctional biological organic composite coated fertilizer has slow release effects, prolongs fertilizer action time and realizes yield increasing.