Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Corn hundred-grain weight and grain length character compact interlocking molecular marker and application

A molecular marker and 100-grain weight technology, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of no molecular marker, difficulty in character inspection, and difficulty in fine positioning

Active Publication Date: 2019-08-09
HUBEI KANGNONG SEED IND LIMITED
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the grain shape traits are greatly affected by environmental factors, it is difficult to investigate the traits, and finally the identification of QTL loci for grain shape-related traits in maize is in the initial stage of mapping, and fine mapping is difficult. It is difficult to find molecular markers closely linked to yield traits Carrying out molecular marker-assisted selection breeding, although some scholars have found through a large number of studies that chromosome 9 bin 9.03-9.04 is a hotspot area of ​​QTL for yield-related traits, there are still no molecular markers closely linked to yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corn hundred-grain weight and grain length character compact interlocking molecular marker and application
  • Corn hundred-grain weight and grain length character compact interlocking molecular marker and application
  • Corn hundred-grain weight and grain length character compact interlocking molecular marker and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Development of Molecular Markers Closely Linked to 100-kernel Weight and Kernel Length in Maize

[0035] 1 Materials and methods

[0036] 1.1 Test material

[0037] A natural population composed of 368 maize inbred lines with wide sources and rich genetic variation and excellent maize inbred lines Mc and V 671 (Liu et al, 2014).

[0038] 1.2 Test method

[0039] 1.2.1 Field experiment and genotype identification

[0040] The field experiment of associated population materials was carried out in 5 locations in Hubei, Chongqing, Henan, Yunnan and Hainan from 2011 to 2012, using a completely randomized block design, single-row plot, row length 3m, row spacing 0.6m, and 12 seedlings per row. strain. The population genotype data for association analysis is the information of 1.25 million SNP markers in the whole genome (Liu et al., 2017).

[0041] 1.2.2 Phenotype identification

[0042] In each environment, the middle single plant of each inbred line was selec...

Embodiment 2

[0059] Example 2: Genetic improvement of the maize inbred line Mc using the markers developed in Example 1

[0060] 1 Materials and methods

[0061] 1.1 Test material

[0062] Excellent maize inbred lines Mc and V671.

[0063] 1.2 Test method

[0064] 1.2.1 Field test

[0065] From 2015 to 2018, the genetic improvement of the Mc inbred line was carried out by hybridization and molecular marker-assisted selection backcrossing methods; the backcrossing and selection identification of each generation were carried out in two locations in Wuhan, Hubei, and Hainan, China.

[0066] 1.2.2 Phenotype identification

[0067] There were 12 plants in each row, and 5 well-pollinated ears were selected in the middle of each row, and the kernel size and 100-kernel weight (H KW, 100-Kernel weight) traits in the middle of 5 ears were measured. The measured traits were measured three times to get the average value.

[0068] 1.2.3 Genotype analysis

[0069] Genotyping involves DNA extracti...

Embodiment 3

[0074] Example 3: Application of molecular markers closely linked to corn kernel length and 100-kernel weight in corn breeding:

[0075] 1. Materials and methods

[0076] 1.1 Test material

[0077] Maize inbred line Mc and its improved line Mc R , 7 elite maize inbred lines: Zheng 58, Chang 7-2, 6WC, ZZ01, 4CV, Ye 478 and B73 (Li et al., 2013).

[0078] 1.2 Test method

[0079] 1.2.1 Mc and Mc R Combined F with 7 excellent inbred lines 1 combination

[0080] Zheng 58, Chang 7-2, 6WC, ZZ01, 4CV, Ye 478 and B73 were compared with the Mc R (Using molecular marker L1 for assisted selection, the size of the amplified band is 188bp) and Mc (using molecular marker L1 for assisted selection, the size of the amplified band is 476bp) hybridization with non-synergizing sites, and 14 F 1 Combine; plant 14 F 1 Combine and investigate the grain length (KL), grain width (KW) and hundred-kernel weight (HKW) of each combination.

[0081] When the size of the amplified band of molecula...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and discloses development and application of a molecular marker for controlling corn hundred-grain weight and grain length character compact interlocking. A primer designed according to the molecular marker is L1-F:GCCGGAGTGAGCTGGCAGAA and L1-R:GGGAACGGCGAGATATTTTG. The inventor identifies and develops the molecular marker for corn hundred-grain weight and grain length character compact interlocking. The molecular marker has the potential breeding value. Molecular breeding auxiliary selection is performed through the marker, the corn hundred-grain weight and grain length yield character can be remarkably increased, and therefore the yield increase effect is achieved. The molecular marker can be used for molecular marker auxiliary selection and breeding.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to molecular markers and applications of closely linked 100-kernel weight and kernel length traits of corn. Background technique [0002] Corn yield is mainly composed of the number of corn per unit area, the number of grains per plant, and the hundred-kernel weight, among which the hundred-kernel weight (Hundred-KernelWeigh, HKW) can significantly affect the corn yield, and the kernel weight is determined by the kernel length (KernelLength , KL), grain width (Kernel Width, KW) and grain thickness (Kernel Thickness, KT) are jointly determined. Related studies have shown that there is a significant positive correlation between corn grain length traits and corn yield (Li Yongxiang, 2009; Li Bo, 2014). Deep mining of molecular markers closely linked with grain shape traits of maize is of great significance for breeders to improve maize yield through grain shape related traits....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 彭绪冰邱法展龚佃明彭绪伟
Owner HUBEI KANGNONG SEED IND LIMITED
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com