69results about How to "Help determine" patented technology

The invention provides a graphic user interface used in a study system of plural micronization and structuration-based knowledge points, which is provided with a graphic window, wherein the graphic window comprises a plurality of layers of selectable elements used for guiding a user to select the knowledge points to learn. Once a knowledge point is selected by the user, the graphic window displays the information content of the selected knowledge point in a graphic display area for the user to learn and provides a feedback such as an answer. Once receiving a user feedback input by the user through a user interactive element, the graphic window displays an assessment result fed back by the user. The additional selectable elements can be used for selecting the type of the information content to be displayed (such as knowledge content and assessment content). The graphic user interface also adopts an additional graphic window for facilitating the query and review of the user and displaying the study statistical data of the user.

The invention discloses a network security source analysis method and device. Log information of various types of network equipment is acquired in real time and fixedly saved, and therefore logs can be restored when the logs are attacked to be cleared; the acquired log information is subjected to deep association analysis and data mining, and a generation vein and an attack path of an attack eventare combed out to acquire related information and behaviors of an attacker, feature attributes are extracted, and an attacker relation model is built; and related information and behaviors of a visitor are acquired, feature attributes of the related information and behaviors of the visitor are matched with the attacker relation model, and therefore whether or not the visitor is the attacker can be determined.

The invention relates to a monitoring method and system, electronic equipment and a storage medium, and the method comprises: carrying out the target region recognition of a visible light image, and obtaining a first region where a target object is located and a second region where a preset part is located; performing living body detection on the target object according to the size of the first area and a third area corresponding to the first area in the infrared image to obtain a living body detection result; when the living body detection result is a living body, carrying out identity recognition on the first area to obtain identity information, and carrying out temperature detection on a fourth area corresponding to the second area in the infrared image to obtain temperature information; and generating first early warning information according to the identity information under the condition that the temperature information is greater than or equal to a preset threshold. According tothe monitoring method provided by the embodiment of the invention, living body detection and temperature detection can be carried out based on the infrared image, the body temperature of the target object in the image can be rapidly detected, the body temperature detection efficiency is improved, and the monitoring method is suitable for places with large pedestrian volume.

The invention discloses a device for measuring wave aberration of a projection lens. The device comprises: object plane rough measurement grating mark and precise measurement grating mark for generation of first diffracted lights; image plane grating mark containing image plane rough measurement grating mark and precise measurement grating mark; and an image detector. The diffracted lights generated from the object plane grating mark are gathered at the image plane grating mark by the projection lens, so as to generate secondary diffraction. Secondary diffracted lights generate interferograms in far field. According to the shearing interferograms measured by the image detector, the wave aberration of the projection lens is calculated. The invention simultaneously discloses the method for measuring the wave aberration of the projection lens.

The invention discloses an immunochromatographic strip for detecting viscerotropic leishmania infection and diagnosing kala-azar, which comprises a sample pad, a conjugate pad which is closely connected to the sample pad and contains a colloidal gold-labeled probe, a cellulose membrane closely connected with the conjugate pad and a water absorption pad closely connected to the cellulose membrane. The water absorption pad is far away from the conjugate pad, a quality control line is arranged at one end of the cellulose membrane, which is close to the water absorption pad, a detection line is positioned on the cellulose membrane between the quality control line and the conjugate pad, the detection line contains soluble antigen of the viscerotropic leishmania, and the quality control line contains antibodies specifically binding to the colloidal gold-labeled probe. The invention further provides a kit containing the immunochromatographic strip and a preparation method for the immunochromatographic strip. The immunochromatographic strip has the advantages of being simple and convenient to use, high in sensitivity and specificity, fast in detection, and simultaneously applicable to clinical and field use for human, livestock and wild animals.

The invention relates to an infrared intelligent online monitoring system for a direct-current convertor station valve hall. The infrared intelligent online monitoring system comprises a thermal infrared imager, an optical transmitter and receiver, a switch, a background controller, a visible light camera, a micro controller, a cradle head and a controllable track, wherein both the thermal infrared imager and the visible light camera are arranged on the cradle head, and are connected with the micro controller and the optical transmitter and receiver; the cradle head is arranged on the controllable track; the micro controller is connected with the cradle head and the controllable track respectively; the optical transmitter and receiver is connected with the switch; and the switch is connected with the micro controller and the background controller respectively. Compared with the prior art, the infrared intelligent online monitoring system has the advantages that each heating element of a valve body can be subjected to infrared monitoring in real time; meanwhile, an alarm signal is transmitted according to a preset early warning value, and the running safety of equipment is ensured by means of lowering of the load or change of the system running way and the like, so that the equipment running safety is ensured, and the identification capability and foreseeability of running personnel specific to equipment defects are enhanced; and the infrared intelligent online monitoring system has the advantages of simple structure, convenience in installation, high instantaneity and the like.

The invention provides an online detecting method of a spiral bevel gear machining process. The method comprises the following steps of 1, directly acquiring point cloud data of a gear on a gear machining machine tool by using a laser scanner; 2, pre-processing the point cloud data of the gear, converting the point cloud data into curve surface data with st1 format, and according to the curve surface data, building a reconstruction model of the detected gear; 3, taking the designed model of the gear as a reference target, re-positioning the reconstruction model of the gear; 4, making section lines of the reconstruction model and the designed model of the gear along the gear height direction and the gear length direction of the gear, and measuring the deviation value of the section lines. Online detection on a spiral bevel gear can be realized, and the gear is not required to be loaded or unloaded for multiple times in a detecting process, so that mounting error is avoided.

The invention relates to an LED array drive circuit, a drive chip, an LED display screen and a short-circuit point positioning method, and the drive circuit is used for assisting in detecting the position of a short-circuit point in an LED array, and comprises the LED array, a row drive array, a column drive module, a detection channel gating unit and a power supply, wherein the row driving arraycomprises a plurality of row channels, and the column driving module comprises a plurality of column driving channels for scanning and driving the LED array; the detection channel gating unit comprises a plurality of detection channels, and one detection channel is electrically connected with one column driving channel; and when the positions of the short-circuit points are detected, all the row channels are closed, one of the two column driving channels connected with the short-circuit points is opened, the other column driving channel is closed, the detection channel connected with the opened column driving channel is closed, and the detection channel connected with the closed column driving channel is opened, so that a path passing through the short-circuit points is formed. The position of the short-circuit point is greatly convenient to determine, the maintenance difficulty is reduced, and the maintenance efficiency is improved.

The invention discloses a method for analyzing phenolic compounds in water, used for qualitatively or quantitatively analyzing the phenolic compounds in a water sample. The method comprises the following steps of 1, producing a standard curve; 2, preparing sample liquid to be detected: preprocessing a surface water sample to be detected to acquire the sample liquid to be detected; 3, detecting andanalyzing the sample liquid to be detected by using gas chromatography-low energy electron ionization quadrupole time-of-flight mass spectrometry (GC-le EI-QTOF); and 4, reviewing the sample that isdetected to be positive, namely that includes the phenolic compounds, by using gas chromatography-triple quadrupole mass spectrometry (GC-QQQ). The method provided by the invention is high in resolution, high in sensitivity, and capable of accurately determining the nature of a target, and excluding interferent of which a mass-to-charge ratio is close to that of the target.

The invention belongs to the technical field of medicine and discloses a tofacitinib crystal form compound and a preparation method thereof. The X-ray powder diffraction spectrum shown by the 2 theta +-0.2 degree diffraction angle shows characteristic diffraction peaks at 2.42 degrees, 3.25 degrees, 4.23 degrees, 5.04 degrees, 6.12 degrees, 7.08 degrees, 8.02 degrees, 9.72 degrees, 10.63 degrees, 12.90 degrees, 14.35 degrees, 15.71 degrees, 17.82 degrees, 18.34 degrees, 19.24 degrees, 22.46 degrees, 24.56 degrees, 26.62 degrees, 30.75 degrees and 32.45 degrees, and the X-ray powder diffraction spectrum obtained by Cu-K alpha ray measurement and shown by the figure I is totally different from the prior art. The tofacitinib crystal form compound has better water solubility and high stability, the preparation method is simple and easy to operate, the medication safety is improved greatly after the compound is prepared into a drug composition, and the compound is very suitable for clinical application.

The invention provides amorphous entecavir p-toluenesulfonate salt with high bioavailability, high stability, high yield and high purity. The amorphous entecavir p-toluenesulfonate salt is determined as an amorphous state of entecavir p-toluenesulfonate salt through detections such as X-ray diffraction, infrared absorption spectrum determined by a KBr tablet method, differential scanning calorimetry (DSC) and the like. The invention also relates to a preparation method and medicament application of the amorphous salt.

The invention discloses a shield underneath pass existing structure construction risk evaluation method, which mainly comprises the following steps of establishing a construction safety risk evaluation index model of a shield underneath pass existing structure based on related literature and engineering experience; acquiring detection data, and performing optimal edge distribution identification on the evaluation indexes based on the monitoring data; constructing a PCBN model based on a Bayesian network, performing risk reasoning, and determining an engineering construction risk level; and onthe basis of the constructed PCBN model, carrying out evaluation index correlation analysis based on a percentage arachnogram and correlation coefficients, and determining key risk factors of the project. According to the method, the Pair-Copula theory and the Bayesian network are combined, inference analysis is carried out on the uncertain risk information, the construction risk state and potential key risk factors of engineering are effectively determined, and more accurate and reasonable construction safety risk comprehensive evaluation of shield underneath passing existing buildings is achieved.

The invention discloses a biological marker used for prediction of responsiveness of breast cancer patients on AT programme neoadjuvant chemotherapy. The biological marker is miR4772-3p. It is confirmed by experiments that: the miR-4772-3P expression level in blood exosome of curative effect SD group breast cancer patients is increased obviously compared with that of curative effect PR group breast cancer patients, so that miR4772-3p can be taken as the biological marker used for prediction of responsiveness of breast cancer patients on AT programme neoadjuvant chemotherapy. The research results can be used for providing guidance for development of therapeutic schedules of breast cancer patients by clinical doctors.

The invention provides a tumor recognition system based on artificial intelligence. The tumor recognition system comprises an image acquisition module, an image library, an image preprocessing module,an image feature extraction module and a tumor recognition module. The tumor recognition method comprises the steps that S1, noise reduction processing is conducted on a CT image of a human organ tobe detected, and then an image feature extraction module extracts image texture features; S2, a focus recognition BP neural network recognizes whether the human organ CT image contains a suspected focus area according to the image texture features; S3, an image preprocessing module performs image segmentation on the human organ CT image containing the suspected lesion area to obtain an area wherea suspected lesion is located; S4, after the region where the suspected focus is located is enhanced, texture features and shape features are further extracted; and S5, the focus type is identified bythe tumor identification BP neural network, and finally benign and malignant identification of the tumor is realized. Compared with the prior art, the method has the advantages of high recognition rate and high recognition accuracy.

The invention discloses a fill settlement prediction method based on a centrifugal model test, and relates to the technical field of fill engineering, and the method comprises the following steps: S1,setting a special model box for a fill engineering settlement test, and enabling the interior of the model box to be a separation model space; S2, manufacturing a centrifugal model sample of the engineering key node, and manufacturing a centrifugal model sample of general regularity research of the multi-parameter influence; S3, performing data transmission with a centrifugal machine in the modelbox, and completing a personalized model test and a generic model test; and S4, drawing a space scatter cluster, performing fitting, performing smoothing and generating a three-dimensional space curved surface. According to the method, time cost and economic cost are saved, fill settlement of objective entity working conditions can be simulated in advance, and the method can be used for comparison and selection of multiple alternative schemes and optimization of design parameters; three parameter relations related to settlement can be established at the same time, a space curved surface is formed, and tedious operation of field tests or numerical calculation is avoided.

The invention discloses a nucleic acid detection kit for detecting BRCA1mRNA (breast cancel susceptibility gene1 messenger ribonucleic acid). The nucleic acid detection kit comprises red blood cell lysis buffer, RNA extracting solution, detection system PCR (polymerase chain reaction) liquid, a positive reference substance and a negative reference substance. The nucleic acid detection kit is characterized in that the detection system PCR liquid comprises PCR buffer solution, dNTP (diethyl-nitrophenyl thiophosphate), Mg<2+>, upstream and downstream primers BRCA1-F / BRCA1-R and a probe BRCA1-Probe for detection, upstream and downstream primers Actin-F / Actin-R probe Actin-Probe for reference, in which, BRCA1-F:CAGCTACCCTTCCATCATAAGTGA; BRCA1-R:GGCCATGTATATGCGAATCTTTTT; BRCA1-Probe:FAM-TTCTGCCCTTGAGGACCTGCGAAAT-TAMRA; Actin-F:TGAGCGAGGCTACAGCTT; Actin-R:TCCTTGATGTCGCGCACGATTT; Actin-Probe:FAM-ACCACCACGGCCGAGCGG-TAMRA.

The invention provides an image model construction method, an image model construction device and electronic equipment and relates to the technical field of medicine-based image processing. The imagemodel construction method comprises the following steps: obtaining a preset three-dimensional meridian model, a three-dimensional body model of a target human body and a body surface temperature distribution image of the target human body; fusing the preset three-dimensional meridian model, the three-dimensional body model and the body surface temperature distribution image to obtain a fused imagemodel; and rendering three-dimensional meridians in the fused image model based on the body surface temperature distribution image and preset human body heat transfer rules to obtain a body internaltemperature distribution image model of the target human body. Based on the image model construction method, the image model construction device and the electronic equipment provided by the invention,on the one hand, medical personnel can diagnose patients to be diagnosed through temperature distribution of the three-dimensional meridians, thereby being favorable for accurately determining the specific parts of lesions; and on the other hand, based on the determined parts of the lesions, the medical personnel can favorably determine specific pathological mechanisms to determine treatment means, thereby realizing the targeted treatment and improving the medical treatment effect.

A method and an apparatus for capturing a visual field of a person having a scotoma, in particular a central scotoma, are disclosed. The method includes continuously capturing the eye alignment of the person with a capturing unit, sampling the visual field of the person point-by-point to determine points suitable and not suitable for sight in the visual field of the person, finding the scotoma as a region with a multiplicity of points not suitable for sight, calculating an outer boundary line (12) of the scotoma, calculating an outer enveloping curve (13), which surrounds the outer boundary line (12) of the scotoma at a predetermined distance, and displaying the outer enveloping curve on a display unit (1). The enveloping curve is perceivable by the person on the display unit as a frame of the scotoma.

The invention belongs to the field of pesticides and discloses refined glufosinate acid aquo-complex crystals and a preparation method thereof. The refined glufosinate acid aquo-complex crystals are refined glufosinate acid-aquo-complex crystals. An X-ray powder diffraction spectrogram represented by diffraction angles: 2theta+ / -0.2 degrees of the quo-complex crystals shows characteristic diffraction peaks (shown as a figure 1) at 2theta: 14.67 degrees, 17.17 degrees, 20.83 degrees, 22.23 degrees, 22.43 degrees, 23.12 degrees, 25.99 degrees, 27.66 degrees, 30.68 degrees, 34.69 degrees and 41.34 degrees. The characteristic diffraction peaks are obviously different from those in the prior art. The refined glufosinate acid-aquo-complex crystals have good performance and are quite suitable foractual applications. The invention also discloses a preparation method for the refined glufosinate acid-aquo-complex crystals. The preparation method is simple and mild and suitable for industrial production.

The invention discloses a method and device for calculating an equivalent minable thickness ratio of a coal mine goaf for an overhead transmission line. The method comprises the following steps: calculating an equivalent thickness of each rock-soil layer above the gaof; accumulatively summing the equivalent thicknesses (shown in the specification) of all the layers of an overlying rock-soil layer so as to calculate a total equivalent thickness, corresponding to a standard medium, of the overlying rock-soil layer; calculating the equivalent minable thickness ratio of the goaf according to a mining thickness of a coal bed and the total equivalent thickness of the overlying rock-soil layer. Based on sufficient calculation theoretical basis and comprehensive consideration, a result is reliable; the influence degree of the thickness and the nature of the overlying rock-soil layer on surface deformation can be reasonably considered; the severity of actual surface deformation can be accurately reflected; evaluation of the dangerousness of the surface deformation of the goaf where the transmission line passes can be facilitated; determination of a reasonable planning, construction and operation technical scheme for the overhead transmission line of the coal mine goaf can be facilitated; the method has important guidance significance and reference value for guaranteeing the safety of the transmission line.

The invention discloses a road occupation information determination method and device, belongs to the field of computer vision, and can be used for auxiliary driving and automatic driving. The method comprises the steps that a first image is acquired, a first region of interest (ROI) is determined according to the first image, and the first ROI comprises at least one construction area marker; obtaining a first binary image of the ROI; performing edge enhancement processing on the at least one construction area marker in the first binary image to obtain a second binary image; obtaining a junction point set of the at least one construction area marker and the road surface according to the second binary image; and determining road occupation information of the at least one construction area marker according to the junction point set of the at least one construction area marker and the road surface, and sending the road occupation information. According to the method, the accuracy of determining the road occupation information of the construction area markers is improved, so that the decision-making accuracy of the vehicle in auxiliary driving and automatic driving is improved.

The invention relates to a compound crystal form and a preparation method thereof, in particular to a crystal form I of a deuterated osimertinib pharmaceutical salt as well as a preparation method andapplication thereof. An X-ray powder diffraction pattern of the crystal form represented by a 2theta angle has characteristic diffraction peaks at positions of 5.49 + / -0.2 degrees, 6.42 + / -0.2 degrees, 11.01 + / -0.2 degrees, 11.61 + / -0.2 degrees, 12.46 + / -0.2 degrees, 13.42 + / -0.2 degrees, 14.22 + / -0.2 degrees and 15.58 + / -0.2 degrees. The crystal form is not easy to absorb moisture, has higher solubility, better stability, better fluidity and preparation processability, and has important significance in preparation of EGFR tyrosine kinase inhibitor drugs. The invention also discloses the preparation method of the crystal form I of the deuterated osimertinib pharmaceutical salt, and the crystal form I obtained by the preparation method has higher purity and higher yield.

The invention provides a lansoprazole crystal compound with favorable solubility and stability. The invention also provides a preparation method of the lansoprazole crystal compound and a pharmaceutical composition containing the lansoprazole crystal compound. The crystal compound is suitable for preparing any dosage forms including enteric-coated tablets, enteric capsules, enteric granules, lyophilized agents and the like which are pharmaceutically accepted. The invention also provides the preparation method of the lansoprazole crystal compound and an application of the lansoprazole crystal compound to the treatment of stomach illness.

The invention discloses flexible public place carbon dioxide detection apparatus. The flexible public place carbon dioxide detection apparatus is used for sanitation examination in public places, andcomprises a supporting base, a push plate, a workbench, a carbon dioxide detector and a lifting assembly. With the flexible public place carbon dioxide detection apparatus, the problem that because apparatus in the prior art can only move upwards and downwards, cannot move leftwards and rightwards while moving upwards and downwards, the accuracy of a detection result is affected. The push plate isriveted to the left side of the supporting base. The push plate is arranged in an inclined manner. A handle is installed at the upper end of the push plate. A guide rod is welded to the upper surfaceof the supporting base. A storage battery is installed at the bottom of the guide rod. A controller is fixedly installed on the storage battery. The workbench is arranged above the guide rod. The carbon dioxide detector is installed on the workbench. The lifting assembly is arranged between the supporting base and the workbench. The flexible public place carbon dioxide detection apparatus is easyto operate, stable in supporting, wider in detection range compared with the apparatus in the prior art, convenient and flexible to operate, and suitable for measuring the content of carbon dioxide in public places.

The invention discloses a DC power distribution network fault disturbance identification method based on a mutation integral product. According to the method, mutation integral operation of a mode current at two sides of a DG or a micro-power-grid in a DC power distribution network is performed during a fault transient-state period, an operation result is regarded as identification basis of line fault and power disturbance of the DC power distribution network based on the mutation direction and a product result, a disturbance identification signal is transmitted to a converter station, protective maloperation caused by power fluctuation of the DG (micro-power-gird) can be effectively avoided, and the determination of a fault occurrence section is assisted. According to the method, comparedwith non-unit protection, selectivity and reliability are further achieved, only identification information during the transient-state period needs to be transmitted, the communication traffic is small, the time delay is short, speed is further achieved compared with differential protection, and a certain application value is provided in the DC power distribution network with short lines.

The invention provides a method for constructing a curcuminoid SULTs metabolism finger-print and an application. The method provided by the invention comprises the steps of: choosing and recombining SULTs, and catalyzing the sulfonated conjugation reaction of the curcuminoid by virtue of the in vitro incubation system thereof. The biological activity thereof is obtained through quantitatively determining the production of a conjugation product or the eliminated amount of a substrate within unit time, and the SULTs finger-print is established. The method establishes the finger-print of the sulfonated metabolic reaction of the SULTs mediate curcuminoid, and supplements the relevant technology of the finger-print in the field for the first time. The finger-print obtained can be used to describe and predict the in vivo and in vitro drug metabolism properties of the curcuminoid, is conducive to expounding the mechanisms such as the detoxifying ways of such compound, the drug interaction and the like, and provides both theoretical basis for development of new drugs of such drugs and scientific guidance for safe, reasonable and effective use of such drugs clinically.

The present invention discloses a converter current inner ring optimal gain determination method. The method comprises the steps of: establishing a mathematical model of a controlled object in a discrete domain; defining a minimal function of distances from closed-loop poles to a unit circle, scanning controller gains, obtaining the position of one closed-loop pole corresponding to each controllergain, and obtaining a relation curve of the minimum distance from the closed-loop poles to the unit circle; and finally, on the premise of the a stable system, calculating the maximum value of the relation curve from the closed-loop poles to the unit circle, wherein the controller gain corresponding to the maximum value is a current loop optimal gain. A simple and visual determination method is provided for the current inner ring gain of the double closed loop control to optimize the system damping, inhibit the resonance of an output LC filter and provide theoretical basis for voltage outer ring parameter design on the premise of achieving the optimal gain.

The invention belongs to the technical field of medicine, and discloses a crisaborole crystal form compound and a preparation method thereof. The crisaborole crystal form compound displays characteristic diffraction peaks at 2[theta]+ / -0.2 degree of 6.02 degrees, 12.04 degrees, 15.13 degrees, 15.35 degrees, 18.09 degrees, 24.20 degrees and 26.08 degrees in an X-ray powder diffraction pattern, andthe X-ray powder diffraction pattern obtained through Cu-K alpha ray measurement is completely different from the prior art. According to the invention, the crisaborole crystal form compound has goodwater solubility and high stability, the preparation method is simple and easy to operate, the medication safety is greatly improved after the compound is prepared into a pharmaceutical composition, and the crisaborole crystal form compound is very suitable for clinical application.

The invention discloses an electronic product comprehensive stress dust test evaluation method, and belongs to the field of reliability test. The method comprises the following steps: firstly, carrying out investigation and information collection on an actual application environment of a to-be-evaluated electronic product, and carrying out classified statistical analysis on related data; secondly, according to a data analysis result in the first step, comprehensive stress sand and dust test severity selection and test profile design are carried out; then, according to the test conditions and the profile designed in the step 2, specific implementation of the test and monitoring of key parameters are carried out; and finally, carrying out performance characterization test and risk grade judgment on the test sample. Based on the actual application environment characteristics of the product, the temperature stress and sand dust comprehensive stress condition is introduced, and the risk grade of the product is evaluated under the temperature and humidity conditions, so that the application environment of the product can be simulated more appropriately, and the reliability of the electronic product under the comprehensive sand dust stress condition is evaluated more perfectly.

The invention belongs to the technical field of medicine and discloses a tofacitinib crystal form compound and a preparation method thereof. The X-ray powder diffraction spectrum shown by the 2 theta +-0.2 degree diffraction angle shows characteristic diffraction peaks at 2.42 degrees, 3.25 degrees, 4.23 degrees, 5.04 degrees, 6.12 degrees, 7.08 degrees, 8.02 degrees, 9.72 degrees, 10.63 degrees, 12.90 degrees, 14.35 degrees, 15.71 degrees, 17.82 degrees, 18.34 degrees, 19.24 degrees, 22.46 degrees, 24.56 degrees, 26.62 degrees, 30.75 degrees and 32.45 degrees, and the X-ray powder diffraction spectrum obtained by Cu-K alpha ray measurement and shown by the figure I is totally different from the prior art. The tofacitinib crystal form compound has better water solubility and high stability, the preparation method is simple and easy to operate, the medication safety is improved greatly after the compound is prepared into a drug composition, and the compound is very suitable for clinical application.