Nucleic acid detection kit for detecting BRCA1mRNA (breast cancel susceptibility gene1 messenger ribonucleic acid)
A detection kit and nucleic acid technology, applied in the fields of life science and biology, can solve the problems of high cost and inferior specificity, and achieve the effect of reducing detection cost, simple operation and saving detection time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] The nucleic acid detection kit for detecting BRCA1mRNA of the present invention comprises:
[0024] Red blood cell lysate;
[0025] RNA extraction solution: QIAGEN RNeasy FFPE Kit.
[0026] Detection system PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2×) (including PCR buffer, d NTP, Mg 2+ ), BRCA1 primers each 0.8uM, BRCA1-probe (probe) 0.4uM; Actin primers each 0.8uM, Actin-probe (probe) 0.4uM; among them,
[0027] BRCA1-F: CAGCTACCCTTCCATCATAAGTGA,
[0028] BRCA1-R: GGCCATGTATATGCGAATCTTTTT,
[0029] BRCA1-Probe: FAM-TTCTGCCCTTGAGGACCTGCGAAAT-TAMRA,
[0030] Actin-F: TGAGCGAGGCTACAGCTT,
[0031] Actin-R: TCCTTGATGTCGCGCACGATTT,
[0032] Actin-Probe: FAM-ACCACCACGGCCGAGCGG-TAMRA;
[0033] Positive control substance: solution containing BRCA1 genome;
[0034] Negative control substance: no BRCA1 genome solution.
Embodiment 2
[0036] The using method of kit of the present invention:
[0037] (1) Extract tissue RNA from paraffin slices: cut out the tissue or paraffin slice samples and place them in a 1.5ml centrifuge tube (scrape); add 1ml tissue clear solution, shake and mix well, and centrifuge at 13000rpm for 1min; remove the supernatant and add 500ml tissue Centrifuge at 13,000rpm for 1min after shaking and mixing the transparent liquid; remove the supernatant, add 1ml of absolute ethanol, shake and mix, and centrifuge at 13,000rpm for 1min; remove the supernatant and put it in a 37-degree metal bath for 10min (open the cover) until the liquid is dry; refer to QIAGEN RNeasy FFPE Kit paraffin RNA extraction kit instructions, extract sample RNA.
[0038] (2) Refer to the instructions of the Rever Tra Ace qPCR RT Kit kit from TOYOBO to reverse RNA to cDNA.
[0039] (3) Reagent configuration: according to the number of people to be tested, X ul of the PCR reaction solution of the detection system is...
Embodiment 3
[0049] Using the nucleic acid detection method of the present invention to detect clinical specimens
[0050] Take 20 cases of paraffin section specimens from breast cancer patients (using double-tube fluorescent quantitative PCR technology), extract genomic RNA, prepare reagents and detect according to the method described in Example 2.
[0051] Add 2ul of each sample to the detection system PCR reaction solution. At the same time, make a standard curve of positive, negative, blank control, and internal reference gene / target gene. A 96-well fluorescent PCR instrument can detect 20 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is only 100 minutes.
[0052] The experimental results were compared with the reported results of the PCR group to determine the accuracy of the sample detection. Some positive results are as follows:
[0053] Sample
Internal reference expression
...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com