82results about How to "Shorten monitoring time" patented technology

A power distribution system is adapted to a management module connected to a plurality of servers, each of which is varied in power consumption in response to a power mode and performance thereof, via a power allocation request line and a power allocation response line. The management module records the upper-limit power setting, the power allocations, and the power pool with regard to the servers. The server records the power mode, the power allocation, the upper mode request threshold, and the redundant power which is calculated based on the difference between the power allocation and the actual power consumption. The management module recovers the redundant power from the server so as to update the power pool. Upon receiving a power allocation request, the management module distributes at least a part of the power pool to the server, thus allowing the server to shift the power mode to the upper mode.

The invention discloses an Internet of Things safety monitoring method and system based on double engines, and the method comprises the steps: deploying a detection processing engine in an Internet ofThings sensing layer in advance, and deploying a collection analysis engine in a network layer of the Internet of Things; discovering and identifying terminal equipment of the Internet of Things through a detection processing engine, obtaining equipment information of the terminal equipment, and reporting equipment attributes and equipment state information to an acquisition analysis engine; andacquiring, by the acquisition and analysis engine, flow data of a network core switch, constructing a network behavior analysis model of the terminal equipment according to the flow data and equipmentinformation of the terminal equipment, monitoring abnormal network behaviors by using the network behavior analysis model, and performing alarm and / or blocking operation. Through linkage of the two types of engines, terminal equipment discovery and identification and risk disposal are realized, centralized management and control and behavior analysis are performed on the dispersedly isolated Internet of Things terminals, the comprehensiveness and accuracy of behavior analysis and monitoring are improved, and the disposal efficiency is ensured.

A power distribution system is adapted to a management module connected to a plurality of servers, each of which is varied in power consumption in response to a power mode and performance thereof, via a power allocation request line and a power allocation response line. The management module records the upper-limit power setting, the power allocations, and the power pool with regard to the servers. The server records the power mode, the power allocation, the upper mode request threshold, and the redundant power which is calculated based on the difference between the power allocation and the actual power consumption. The management module recovers the redundant power from the server so as to update the power pool. Upon receiving a power allocation request, the management module distributes at least a part of the power pool to the server, thus allowing the server to shift the power mode to the upper mode.

The invention provides a method for compensating side-wind based on a camera sensor of LKAS in motor-driven power steering. To compensate the side-wide, whether the vehicle is moving straightly is firstly determined. According to the invention, the method uses steering angles and steering angular velocity, and further obtains curvature information of front road, azimuth information among driveway and lateral displacement information relative to the lanes, and the determines whether the vehicle is moving straightly according to the above information. By using the above way, whether the vehicle is moving straightly can be accurately and rapidly determined, and then side-wind can be compensated.

The invention discloses an SCR outlet flue cross section nitric oxide and oxygen concentration online monitoring method and system. The monitoring method comprises the steps that multiple flue gas sampling measuring points are arranged on the measuring cross section according to a grid and divided into a path A and a path B, when monitoring analysis is conducted, flue gas sampling monitoring analysis is conducted on one of the flue gas sampling measuring points on the path A, extraction and discharge are conducted on one of the flue gas sampling measuring points on the path B, after monitoring analysis on the path A is finished, monitoring analysis is conducted on flue gas of the flue gas sampling measuring point subjected to flue gas extraction and discharge on the path B, and meanwhile flue gas extraction and discharge of the flue gas sampling measuring point which is not monitored is conducted on the path A, in this way, the flue gas sampling measuring points of the two paths are subjected to flue gas sampling monitoring and flue gas extraction and discharge alternately. The monitoring system is simplified in structure and low in cost, and online measurement of concentration field distribution of NOx and O2 in SCR outlet flue gas can be effectively achieved.

The invention discloses a system and a method for monitoring the integrity of steel rails of cloud platforms on the basis of guide wave technologies. The system comprises a front-end monitoring module, a cloud monitoring server and a browsing terminal. The front-end monitoring module comprises a guide wave energy transducer, a temperature sensor and a control cabinet, and a solar panel module, a charge and discharge control circuit, an energy storage module, a transmission interface circuit module, a lower computer control circuit module, a communication interface circuit module, a guide wavereceiving and transmitting module and a signal conditioning module are arranged in the control cabinet. The method includes extracting strong-correlation characteristic signals and coefficient matrixes by means of noise reduction; carrying out dimensionality reduction and noise reduction reconstruction to obtain guide wave signals and acquiring damage locations so as to monitor the integrity of the steel rails. Acoustic emission sources at different structural locations of the steel rails can be represented by the characteristic signals and the coefficient matrixes. Damage of the steel rails can be represented by the guide wave signals. The system and the method have the advantages that the integrity of the steel rails can be effectively reliably monitored by the aid of the system and themethod, the monitoring cross-regionalism and timeliness can be greatly improved, and the system and the method have important practical significance and engineering values.

The invention relates to an on-line monitoring system for heating surface ash deposition of a coal-fired power plant boiler, and a detection method of the on-line monitoring system. The heating surface of the coal-fired boiler is divided into a radiation heating surface and a convection heating surface according to different heat transfer modes, corresponding ash deposition monitoring characterization parameters are selected according to the different heating surfaces, and the heating surface ash deposition degree is monitored in real time. According to the invention, real-time and historicaloperation parameters of a field distributed control system and a coal quality detector of a coal-fired power plant are downloaded, real-time data preprocessing and key parameter soft measurement are carried out, a database and an ash deposition monitoring model and a prediction model of each heating surface are built, offline data is applied to train each model, and online monitoring is realized after the target precision is reached. According to the invention, the ash deposition conditions of the different heating surfaces of the coal-fired power plant boiler can be monitored in real time, the ash deposition monitoring result of each the heating surface is output, a theoretical basis is provided for workers to judge ash blowing operation, and then the problem of steam waste caused by lowheat exchange efficiency of the boiler and excessive ash blowing due to insufficient ash blowing, is solved.

The invention discloses a small animal tying device, which comprises a tying device and a sheath, wherein the tying device is cylindrical; one end of the tying device is sealed; the other end of the tying device is provided with an opening; the appearance of the sheath is cooperated with the appearance of the tying device; the sheath is covered on the tying device; the bottom of the sheath is covered on the opening; the sheath is provided with a zipper with double sliders, wherein the zipper with double sliders penetrates through the bottom of the sheath; the zipper with double sliders comprises a first slider and a second slider, wherein the first slider is provided with a first semi-ring, and the second slider is provided with a second semi-ring; the first semi-ring and the second semi-ring are used for being mutually cooperated on the bottom of the sheath to form a tail hole through which the tail of a small animal passes after the zipper with double sliders is closed. According to the small animal tying device, the small animal can be quickly, conveniently and effectively tied and fixed, the position of the tail hole can be regulated according to the figure and the tail height of the small animal, the tail of the small animal is prevented from being forced, so that the monitoring time can be shortened, and the monitoring precision is improved.

The invention provides a postoperative self-help rehabilitation nursing bed, and mainly relates to the field of medical equipment. The postoperative self-help rehabilitation nursing bed comprises a bed body, wherein a back plate is arranged in the middle of the bed body; a supporting device is arranged on the back plate; a fixed seat is arranged at the tail end of the bed body; two beam columns are arranged at the bottom of the fixed seat; a spring rod is arranged between each beam column and the fixed seat; a blocking rod is arranged at the tail end of the bed body; extending rods are arranged at the top of each beam column; a pedal is arranged at one end, far from the beam column, of the extending rod. The postoperative self-help rehabilitation nursing bed has the benefits that the intensity of rehabilitation exercise can be better adjusted, which ensures that the patient performs rehabilitation exercise step by step, improves the effect of rehabilitation exercise, reduces the probability of occurrence of accidents during rehabilitation exercise, can shorten the nursing time of nursing personnel during the rehabilitation exercise processes, and saves the energy and strength of the nursing personnel.

The invention belongs to the field of hospital infection equipment, and provides a hospital infection equipment remote monitoring management system and method. The hospital infection equipment remote monitoring management system comprises hospital infection equipment and further comprises a front end device and a center server. The front end device is connected with the hospital infection equipment and used for receiving a hospital infection equipment control command from the center server of the hospital infection equipment remote monitoring management system, controlling the hospital infection equipment according to the hospital infection equipment control command and acquiring and uploading hospital infection equipment operating data and data of the hospital infection equipment work complete status, wherein the hospital infection equipment operating data and the data of the hospital infection equipment work complete status are fed back by the hospital infection equipment. The center server is connected with the front end device and used for issuing the hospital infection equipment control command to the front end device, receiving the hospital infection equipment operating data and the data of the hospital infection equipment work complete status, processing, counting and analyzing the data and generating a data statistical analysis result, wherein the hospital infection equipment operating data and the data of the hospital infection equipment work complete status are uploaded by the front end device. By the adoption of the system and method, resource cost is saved for enterprises, and monitoring efficiency is improved.

The invention discloses an identification method for voltage dip root-mean-square value and dip frequency estimation. The identification method is characterized by comprising steps of establishing whole grid node voltage dip mode databases of various fault types, constructing a monitored node voltage dip mode, performing identification and classification on voltage dip types and choosing the corresponding whole grid voltage dip mode database according to a short circuit fault type, performing estimation on the voltage dip root-mean-square value of the whole grid nodes, and obtaining a voltage dip frequency estimation value under each voltage dip threshold through statistics. The mode identification method is simple in an estimation principle and an implementation process, high in mode identification accuracy and short in calculation time.

The invention discloses a monitoring system for an offshore wind power foundation. The monitoring system comprises a centralized control center platform and a field monitoring unit arranged on each fan, wherein the field monitoring unit comprises a vibration monitoring unit, a structure safety monitoring unit and a corrosion potential monitoring unit, the vibration monitoring unit comprises a field acceleration sensor, a high-speed acquisition card and an embedded type controller, the structure safety monitoring unit comprises a field sensor, a data acquisition module, a data acquisition controller and a serial port converter, the corrosion potential monitoring unit comprises a cathode protecting system, a signal transformer, a data acquisition module and a micro controller, the field monitoring unit communicates with an offshore booster station platform through an optical fiber, the offshore booster station platform communicates with the centralized control center platform through anEthernet, and a server of the centralized control center platform communicates with a remote authorized user terminal through a wireless network, and the centralized control center platform is based on an B / S system structure. The monitoring system disclosed by the invention realizes a data acquisition function under an unattended operation state.

The invention discloses a frozen soil upper limit change rule testing method. A frozen soil upper limit change rule testing device comprises an outer tank body, an inner tank body, a data collection model and a system control and data collection computer, wherein the inner tank body is located at the inner part of the outer tank body; an outer tank cover and an inner tank cover are respectively arranged on the upper ends of the outer tank body and the inner tank body; a heating module and a refrigerating module are arranged in a position between the outer wall of the left side of the inner tank body and the inner wall of the outer tank body; the heating module and the refrigerating module are respectively communicated with the inner tank body. The invention relates to the technical field of geotechnical testing and measuring. A monitoring sensor buried in a soil sample can be used for monitoring the soil sample temperature change and a moisture migration situation during frozen soil freeze thawing, initial conditions and boundary conditions of a soil temperature conduction and moisture conduction differential equation can be determined according to measured data of the monitoring sensor, analytic solution can be solved according to a variable separation method, an upper limit position change rule can be obtained by combining temperature and moisture judgment criterion and substituting the analytic solution into an analytic solution formula, testing is controlled by a computer system, and a testing result is more accurate.

The invention relates to an intelligent lampblack gas analysis method and an intelligent lampblack gas analysis device capable of shortening the monitoring time. The intelligent lampblack gas analysis device comprises a plurality of sensors, a preprocessing device, a correction device, a calculation device and a communication module, wherein the sensors are used for detecting each detection index of the gas; the preprocessing device is used for preprocessing each acquired detection index, so that the processed detection index can be normally used by other devices; the correction device is used for correcting a pollution gas detection model; the calculation device is used for acquiring and outputting the lampblack concentration comprehensive index according to the corrected pollution gas detection model and the preprocessed detection indexes; the communication device is used for receiving the lampblack concentration comprehensive index and transmitting the lampblack concentration comprehensive index to a monitoring center.

The invention discloses primers and a probe for detecting corruption saccharomycete nucleotide fragments, a detection method using the same and a kit using the same. The primers comprise an upstream primer Yeast F1 and a downstream primer Fungus R1. The upstream primer Yeast F1 has a base sequence of GAAGAGTCGAGTTGTTTGGGAA and the downstream primer Fungus R1 has a base sequence of TCCTTCCCTTTCAACAATTTCAC. The probe has a base sequence of TGTACTTGTTCGCTATCGGTCTCTCGCC. The primers and the probe have good sensitivity and singularity. The whole reaction occurs in an enclosed reaction pipe so that the problem that other nucleic acid detection methods produce aerosol pollution easily thereby producing a false positive result is solved. Through real time monitoring of a PCR product, monitoring time is greatly reduced and labor and material resources are saved.

The invention provides a satellite remote sensing monitoring method for the jujube tree canopy chlorophyll b content. The method comprises the following steps that a to-be-monitored area is determined; a satellite remote sensing image of the to-be-monitored area is downloaded; geometric precision correction, radiation correction and atmospheric correction are sequentially conducted on the downloaded satellite remote sensing image; the satellite remote sensing image obtained after atmospheric correction is cropped to obtain a monitored area image; five vegetation indexes of each pixel selected from the monitored area are calculated through ENVI5.1 software; the five vegetation indexes are substituted into a model through waveband calculation, and the jujube tree canopy carotenoid content of each pixel is calculated, wherein Y is the jujube tree canopy chlorophyll b content, and the unit of the jujube tree canopy chlorophyll b content is mg / g. According to the method, the jujube tree canopy chlorophyll b content data is quickly and accurately acquired in an economical and environment-friendly mode on regional scale, pollution to the environment and harm to human bodies of chemical tail liquid discharge in the measurement process are avoided, the operation steps are greatly simplified, and the monitoring time is shortened.

The invention discloses a water quality monitoring system and a water quality monitoring method. The system comprises a measuring device, a controller, a display, a plurality of reagent containers, a plurality of standby reagent containers, a distilled water container, a cleaning container and a waste liquid container; the measuring device comprises a light source, a rotary light filter plate, a water sample container and a monitoring light receiver; the plurality of reagent containers contain a plurality of reaction reagents for monitoring two pollution factors; each reagent container is equipped with one reaction reagent; the rotary light filter plate comprises at least two light filter plates, and can be used for obtaining monitoring light with at least two wavelengths. By adopting the water quality monitoring system provided by the invention, different wastewater factors can be monitored at the same time by starting the water quality monitoring system once; the same measuring device, the distilled water container, the cleaning container and the waste liquid container are adopted for monitoring different wastewater factors without manually changing the light filter plates, so that wastewater monitoring time is saved, wastewater monitoring cost is reduced and occupied monitoring space is reduced.

The invention belongs to the technical field of environmental protection, specifically relates to an environment-friendly solid waste monitoring device. The device comprises a drug oscillator, a digital PH tester, an electric push rod, a hoop, an interface, a panel, electrodes, a concave hole, a plastic bottle, a bottle cap, a lead, a plug, a round sleeve, a water tank, a filter, a control switch,a water pipe, a nozzle, a circular ring, a first numbering patch, a magnet ring, an iron ring, a second numbering patch and a submerged pump. The device can be used for measuring the PH of solid waste samples; when multiple samples are tested, each sample is matched with one electrode, the electrodes do not need to be cleaned in the test process, and only the electric push rod is lifted up and down and the plug and the interface are plugged in and pulled out, so that the operation process is simple and the monitoring time can be effectively saved; through a washing and water adding structure,water can be added to the samples, and after the PH is measured, the electrodes can be washed through the washing and water adding structure so as to wash the residuals on the electrodes without taking off the electrodes to wash at a pond.

The invention provides an engineering optimization method for improving the water quality pollution monitoring efficiency of a water supply pipe network, and the method comprises the following steps:building and checking a hydraulic model, and building a water quality model based on the hydraulic model; setting optimized parameters of the water quality monitoring system; calculating a water quality pollution probability function of each node; establishing a pipe network water quality monitoring multi-objective optimization function model; adopting an intelligent algorithm to solve the multi-objective optimization function model, so that an optimized solution set is obtained, the monitoring probability of pollution events can be improved, the monitoring time after water quality pollution invasion is shortened, and the method has important scientific significance and application value for urban water supply pipe network water quality safety guarantee.

A statistical method for dynamic spectrum occupancy measurement. The implementation steps are as follows: 1) with the sampling step f3, performing M (img file= '998175DEST_PATH_IMAGE001. TIF' wi= '19' he= '20' / ) for monitoring frequency band (img file= '991539DEST_PATH_IMAGE 002. TIF 'wi=' 19 'he=' 19 ' / ) sub-spectrum monitor sampling, The returned sample values are column vector snapshots (img file= '683552DEST_PATH_IMAGE003. TIF' wi= '139' he= '26' / ); 2) The receiver interference tolerance is (img file= '420563DEST_PATH_IMAGE004. TIF' wi= '26' he= '19' / ). For frequency points (img file= '881632DEST_PATH_IMAGE005. TIF' wi= '21' he= '23' / ), the field strength (img file= '311476DEST_PATH_IMAGE006. TI F 'wi=' 24 'he=' 24 ' / ) to compare and determine that interference tolerance value (img file =' 553102DEST_PATH_IMAGE004. TIF 'wi=' 26 'he=' 19 ' / ), Take (img file= '765908DEST_PATH_IMAGE007. TIF' wi= '47' he= '24' / ), If (img file= '409379DEST_PATH_IMAGE008. TIF' wi= '63' he= '24' / ), then(img file= '183694DEST_PATH_IMAGE009. TIF' wi= '44' he= '22' / ); 3) sample snapshots were divide into (img file = '912615DEST_PATH_IMAGE010. TIF' wi= '17' he= '18' / ) groups, Data matrices (img file= '991430DEST_PATH_IMAGE010. TIF' wi= '17' he= '18' / ) were obtained (img file= '427090DEST_PATH_IMAGE011. TI F 'wi=' 23 'he=' 20 ' / ), Select near (img file= '198737DEST_PATH_IMAGE005. TIF' wi= '21' he= '23' / ) (img file= '87059DEST_PATH_IMAGE012. TIF' w i= '33' he= '19' / ), is a (img file= '218832DEST_PATH_IMAGE010. TIF' wi= '17' he= '18' / ) data matrix (img file= '571315DEST_PATH_IMAGE013. TIF 'wi=' 22'he=' 25 ' / ); 4) Dynamically set the threshold level of the frequency point (img file= '451547DEST_PATH_IMAGE005. TIF' wi= '21' he= '23' / ) (img file= '889481DEST_PATH_IMAGE 014. TIF 'wi=' 35 'he=' 26' / ) and determine possession, take (img file=' 636331DEST_PATH_IMAGE015. TIF 'wi=' 50 'he=' 23 ' / ); If (img file= '108901DEST_PATH_IMAGE016. TIF' wi= '65' he= '26' / ), then (img file= '160034DEST_PATH_IMAGE017. TIF' wi= '46' he= '26' / ); (img file= '85264DEST_PATH_IMAGE018. TIF' wi= '20' he= '25' / ) is (img file= '745790DEST_PATH_IMAGE005. TIF' wi= ' 21 'he=' 23 ' / ) correspond to that field strengthvalues in the data matrix (img file =' 807287DEST_PATH_IMAGE013. TIF 'wi=' 22 'he=' 25 ' / ); 5) Statistical spectrum occupancy (img file= '91638DEST_PATH_IMAGE005. TIF' wi= '21' he= '23' / ) (img file= '441848DEST_PATH_IMAGE019. T IF 'wi=' 140 'he=' 37 ' / ). This method realizes the measurement and statistics of dynamic spectrum occupancy, reduces the monitoring time, improves the calculation precision, and can effectively reflect the occupancy of different frequency bands in real time.

The invention provides a method for quick combinative monitoring of total coliform and escherichia coli. Water fecal pollution indicator bacteria including total coliform and escherichia coli are defected through the most probable number duplex PCR (MPN-dulpex PCR) method. The method is simple and quick, only four steps of experiments are needed, and the detection rate is higher than that of the national standard multi-tube fermentation method; specificity is high, repeatability is good, and two alive indicator bacteria including total coliform and escherichia coli in water can be monitored at the same time in a combinative and quantitative mode. A new method is provided for quick combinative monitoring of the water fecal pollution indicator bacteria including total coliform and escherichia coli.

The invention provides a slope monitoring method based on the multiple unmanned aerial vehicles. The slope monitoring method comprises the steps that multiple monitoring points can be arranged on a slope, all the unmanned aerial vehicles can pass through the slope according to a preset flight route and monitor passing monitoring areas in real time, and when the unmanned aerial vehicles monitor that an abnormal monitoring point with displacement exists in the monitoring areas, the unmanned aerial vehicles can broadcast the geographic coordinates of the abnormal monitoring point to other unmanned aerial vehicles. After other unmanned aerial vehicles receive the geographic coordinates of the abnormal monitoring point, the abnormal condition at the geographic position corresponding to the geographic coordinates can be verified, a verification result is broadcasted to all the unmanned aerial vehicles, and after all the unmanned aerial vehicles receive the verification result broadcasted bythe other unmanned aerial vehicles, whether the monitoring point corresponding to the geographic coordinates truly shifts or not can be judged by integrating the verification results fed back by all the unmanned aerial vehicles. Thus, the verification results can be verified from different positions, directions and the like through the multiple unmanned aerial vehicles, the abnormal monitoring point can be accurately recognized, and the accuracy of the monitoring results is ensured.

The invention discloses a method and device for determining the frozen earth upper limit change rule on the basis of soil water-salt variation. The device comprises an outer box body, an inner box body, a data collection module and a system control and data collection computer, wherein the inner box body is positioned inside the outer box body; an outer box cover is arranged on the upper end of the outer box body; an inner box cover is arranged at the upper end of the inner box body; and a heating module and a refrigeration module are arranged in positions between the left side outer wall of the inner box body and the inner wall of the outer box body. The method and the device relate to the technical field of geotechnical test and measurement. A monitoring sensor buried in a soil sample can be used for monitoring the soil sample water migration and salt accumulation condition during the seasonal frozen earth freezing and thawing; the initial conditions and the boundary conditions of soil water conduction and salt conduction differential equations can be determined according to the measurement by the sensor; an analytical solution can be solved according to a method of separation ofvariables; and finally, the analytical solution is put into an analytical solution formula by combining with the water-salt discrimination criteria to obtain the upper limit position change rule. Thetest progress and the test data monitoring are controlled by a computer system, so that the accuracy is higher.

With respect to a display device having an external compensation function, a monitor time can be shortened without increasing the number of wiring lines. A pixel circuit in an i-th row and a j-th column includes an organic EL element (display element), a writing control transistor, a drive transistor, a monitor control transistor, and a holding capacitor. A control terminal of the drive transistor is connected to a data signal line S(j) in the j-th column via the write control transistor. The monitor control transistor includes a first conduction terminal connected to a second conduction terminal of the drive transistor, and a second conduction terminal connected to a data signal line S(j+1) in a (j+1)-th column.

The invention provides a satellite remote sensing monitoring method for the content of jujube tree canopy carotenoid. The method comprises the following steps of determining a region to be monitored; downloading a satellite remote sensing image of the region to be monitored; sequentially performing geometric precise correction, radiation correction and atmospheric correction on the downloaded satellite remote sensing image; cutting the satellite remote sensing image obtained after atmospheric correction and obtaining an image of the monitored region; calculating the monitored region through ENVI5.1 software for selecting seven vegetation indexes of pixels; substituting the seven vegetation indexes into a model through wave band calculation, and working out the content of the jujube tree canopy carotenoid of each pixel, wherein Y is the content of the jujube tree canopy carotenoid, and the unit is mg / g. According to the method, the content data of the jujube tree canopy carotenoid is rapidly and accurately obtained in the regional scale in an economical and environment-friendly mode, environmental pollution and human injuries caused by chemical tail liquid discharge in the determination process are avoided, the operation steps are greatly simplified, and the monitoring time is shortened.

An optical receiving apparatus includes a variable dispersion compensation unit, a delay interference unit, a photoelectric converter, a polarization control unit for control the polarization state of an optical signal inputted to the photoelectric converter, a received data processing unit for monitoring the number of error occurrences, and a control unit for controlling the dispersion compensation amount at the variable dispersion compensation unit and the optical phase control amount at the delay interference unit, based on information on the number of error occurrences from the received data processing unit. The control unit adjusts the polarization state of the optical signal inputted to the photoelectric converter to a first polarization state, in which errors are more likely to occur than in normal operation, by controlling the polarization control unit and then starts control of the variable dispersion compensation unit and the delay interference unit, and upon completion of the control, adjusts the polarization state of the optical signal to a second polarization state, in which errors are less likely to occur than in the first polarization state, by controlling the polarization control unit.

The invention relates to a method for monitoring vegetation water source conservation amount change. The method comprises the steps of acquiring global land total water reserve change data, rainfall,actual evapotranspiration, soil water reserve, snow melting amount, snow water reserve, surface water reserve, underground water reserve, water resource amount change amount, dry branch and fallen leaf layer interception amount, average natural water content, maximum water holdup and litter accumulation amount; preprocessing data, and calculating the vegetation canopy water storage variation; calculating interception variation of a dry branch and fallen leaf layer; calculating soil water storage variation; and determining the water conservation variable quantity according to the vegetation canopy water storage variable quantity, the dry branch and fallen leaf layer interception variable quantity and the soil water storage variable quantity. A traditional method for calculating the soil water storage capacity through the product of the soil layer thickness and the non-capillary porosity is abandoned, the soil water content remote sensing data provided by NASA is used for calculating thesoil water storage variable quantity, and new technical support and reference are provided for ecological restoration process, ecological effect evaluation and water conservation evaluation.

The invention belongs to the field of foundation pit monitoring, and particularly relates to a mobile terminal intelligent foundation pit monitoring system and method based on photogrammetry. The monitoring system is based on a mobile terminal, and comprises a data input and storage module used for inputting data, downloading data from a cloud end and uploading the data; a camera calibration module which is used for obtaining interior and exterior orientation elements of the camera and adjusting shooting attributes of the camera; a picture screening and processing module which is used for carrying out picture gray scale, size and light sensation processing, picture feature extraction, feature matching and picture splicing; a picture analysis module which is used for calculating data, obtaining internal and external orientation elements and target point coordinates, and judging result rationality; a database which is used for storing and providing data; and a cloud artificial intelligence technology module which is used for being linked with a client database and providing cloud information and artificial intelligence analysis data. The foundation pit safety monitoring system can achieve the function of quickly monitoring the foundation pit safety, effectively save the foundation pit monitoring time, save the management cost, improve the monitoring effect and guarantee the foundation pit construction safety.

The invention discloses a round solid concrete pile body strain monitoring method based on an FBG sensor. The method comprises the steps that smoothness processing is conducted on the surface of a round solid concrete pile body; optical fibers are laid in the axial direction of the surface of the processed pile body, and the FBG sensor connected to the optical fibers in series is bonded to the surface of the pile body; the optical fibers laid on the surface of the pile body are coated with epoxy resin; the ends of the optical fibers are connected into an FBG sensor data acquisition instrument; and the strain value of the pile body is measured. The round solid concrete pile body strain monitoring method based on the FBG sensor has the advantages of being simple in construction and wiring, high in success rate, low in cost, high in precision and the like.