Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers and probe for detecting corruption saccharomycete nucleotide fragments, detection method using the same and kit using the same

A detection method, yeast technology, applied in microorganism-based methods, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of difficulty in screening antibodies, inability to adapt, and high cost, to avoid false negative results, save money The effect of monitoring time and saving manpower and material resources

Active Publication Date: 2014-10-22
SOUTH CHINA UNIV OF TECH
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional culture method is convenient and low in cost, but it takes at least 5 days and cannot meet the needs of modern high-throughput rapid detection; antibody-antigen immunization method has high sensitivity and specificity, but it has high cost and screening antibody Difficulty and the ability to detect multiple antigens at the same time cannot meet the requirements of simultaneous detection of multiple food species spoilage and pathogenic yeast in food

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and probe for detecting corruption saccharomycete nucleotide fragments, detection method using the same and kit using the same
  • Primers and probe for detecting corruption saccharomycete nucleotide fragments, detection method using the same and kit using the same
  • Primers and probe for detecting corruption saccharomycete nucleotide fragments, detection method using the same and kit using the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] A method for detecting common spoilage yeast nucleotide fragments, comprising the steps of:

[0046] 1. Design of primers and probes: By comparing and analyzing the genome sequences of common spoilage yeasts, select a segment with no secondary structure and a high degree of conservation, and design multiple pairs of primers and probes. The length of the primers is generally about 20 bases , there is no complementary sequence between and within the primers. The optimal primer and probe sequence combinations are as follows:

[0047] Upstream primer Yeast F1:GAAGAGTCGAGTTGTTTGGGAA

[0048] Downstream primer Fungus R1: TCCTTCCCTTTCAACAATTTCAC

[0049] Probe Yeast Pb1: TGTACTTGTTCGCTATCGGTCTCTCGCC.

[0050]2. Establishment and optimization of the reaction system: The target region templates used in the establishment and optimization of the reaction system were obtained by the following method: Saccharomyces cerevisiae, Candida parapsilosis, Pichia sparta, Debari hansen Y...

Embodiment 2

[0068] 1. Select the primer pair Yeast F1 / Fungus R1 primer and the probe Yeast Pb1, take the standard strain of Saccharomyces cerevisiae (CICC1001, purchased from the China Industrial Microbiology Culture Collection Management Center) and culture it in a selective medium for a certain period of time, and measure its OD value, estimate the number of bacteria, and then serially dilute 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , to study the sensitivity of the primer and probe system, take 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 Plate counting, the amount of bacterial solution on the plate is 50ul / plate. and put 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 Genomic DNA was extracted with the Takara Yeast Extraction Kit for the five gradient bacterial liquids. For specific steps, refer to the kit instruction manual.

[0069] 2. In the 18 μl detection kit, add 2 μl of each gradient yeast genomic DNA extracted above, and take 2 μl of DEPC water as a negative contro...

Embodiment 3

[0074] 1. Select primer pair Yeast F1 / Fungus R1 primer and probe Yeast Pb1, use bacteria Escherichia coli O157 (NCTC12900, provided by Zhuhai Entry-Exit Inspection and Quarantine Bureau) and mold Aspergillus (HG AO1, provided by Zhuhai Entry-Exit Inspection and Quarantine Bureau) The issue of specificity of this primer and probe system was investigated.

[0075] Genomic DNA was extracted from Escherichia coli O157 using the phenol-chloroform method, and the specific steps were as follows:

[0076] (1) Add the 9 pathogenic bacteria enrichment solutions (about 1 mL) to be tested into 1.5 mL centrifuge tubes, centrifuge at 12000 rpm for 5 minutes, and remove the supernatant;

[0077] (2) Add 700 μL of DNA Lysis Solution, mix well and resuspend, boil in water bath for 5 minutes;

[0078] (3) Add an equal volume of phenol-chloroform (V / V=1:1) solution, mix well and centrifuge at 13000rpm for 5 minutes;

[0079] (4) Transfer the supernatant into another 1.5mL centrifuge tube, add ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers and a probe for detecting corruption saccharomycete nucleotide fragments, a detection method using the same and a kit using the same. The primers comprise an upstream primer Yeast F1 and a downstream primer Fungus R1. The upstream primer Yeast F1 has a base sequence of GAAGAGTCGAGTTGTTTGGGAA and the downstream primer Fungus R1 has a base sequence of TCCTTCCCTTTCAACAATTTCAC. The probe has a base sequence of TGTACTTGTTCGCTATCGGTCTCTCGCC. The primers and the probe have good sensitivity and singularity. The whole reaction occurs in an enclosed reaction pipe so that the problem that other nucleic acid detection methods produce aerosol pollution easily thereby producing a false positive result is solved. Through real time monitoring of a PCR product, monitoring time is greatly reduced and labor and material resources are saved.

Description

technical field [0001] The invention relates to a primer and probe sequence, a detection method and a kit for simultaneous detection of nucleotide fragments of common spoilage yeasts. Background technique [0002] The presence of a large amount of yeast can cause food flavor to decline or deteriorate, and food spoilage caused by yeast has attracted more and more attention. Yeast not only has strong resistance to low humidity, low pH or high-salt and high-sugar foods, but also has strong resistance to preservatives, freezing, and ionizing radiation exposure. With the development of related technologies such as food preservatives and ionizing radiation exposure application, common pathogenic or spoilage bacteria are effectively killed, and yeast becomes the dominant yeast that causes food spoilage. Yeast-induced spoilage is easy to occur in common fermented foods, seafood, pickled foods and other foods. Debaryomyces hansenii, Kluyveromyces marxianus, Kluyveromyces marxianus, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/72C12R1/84C12R1/865C12R1/645
CPCC12Q1/686C12Q1/6895C12Q2563/107
Inventor 肖性龙万松华余以刚吴晖李晓凤胡双芳
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com