47 results about "NdeI" patented technology

The invention discloses a recombinant bacterium and application of the recombinant bacterium to preparation of rebaudioside M2 by catalyzing rebaudioside A. The recombinant bacterium contains a tomato-based glycosyltransferase UGTSL2 gene and a potato-based sucrose synthase StSUS1 gene at the same time; the tomato-based glycosyltransferase UGTSL2 gene is cloned between NdeI and XhoI sites of pRSFDuet-1 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2; then the potato-based sucrose synthase StSUS1 gene is cloned between NcoI and EcoRI sites of the pRSFDuet-SL2 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2-SUS1; the recombinant plasmid pRSFDuet-SL2-SUS1 is transferred into a host cell to obtain the recombinant bacterium. After the recombinant bacterium is subjected to induced expression, crude enzyme liquid is taken and is added into a reaction mixture to catalyze the rebaudioside A to generate the rebaudioside M2; in a reaction process, the crude enzyme liquid obtained by crushing the recombinant bacterium is utilized and separation and purification of an enzyme are avoided; lyophilized powder is also not needed and substrates including rebaudioside D and UDP or UDP-glucose and any cell penetration agent or other chemical reagents do not need to be added, so that the environmental friendliness is better. The yield of the rebaudioside M2 reaches 11.09g / L.

The invention relates to the fields of molecular biology and immunology, in particular to a vibrio harveyi secretory type vaccine and a structure and application thereof. Particularly, the secretory type vaccine is a base sequence in a sequence table SEQ ID No.1, and the construction process thereof is as follows: utilizing vibrio harveyi T4 as a template and F11 and R8 as primers for PCR amplification, connecting the product with pBS-T at room temperature, utilizing NdeI / XhoI double-enzyme cleavage to recover 1.2kb segment from plasmids pBSVhP1, simultaneously utilizing NdeI / XhoI double-enzyme cleavage to recover 4.3kb segment of plasmids pBT3, connecting the two segments at room temperature by ligase T4DNA for 2-4h, transforming connection liquid into colon bacillus DH5 alpha, culturing on an LB solid medium containing Ap for 24h to screen out white transformant, i.e. the Vibrio harveyi secretory type vaccine of base sequence in the expression sequence table SEQ ID No.1. The obtained vaccine has immune and protective functions on Vibrio harveyi. The obtained vaccine has the immune and protective effects on the Vibrio harbeyi, and the immune and protective efficiency of the vaccine of the invention on the Vibrio harveyi can reach to 90%. The preparation process is simple, devitalization and other steps do not needed, and no adjuvant is needed.

The invention provides a method for preparing soluble genetic engineering human serum amyloid A1 (SAA1) and an expression vector and genetic engineering bacteria thereof. The expression vector provided by the invention is a plamid vector pET28a(+) containing a human SAA (hSAA1) gene sequence, and the hSAA1 encoding sequence is positioned between restriction enzyme cutting sites of NdeI and Xhol I on the pET28a(+) vector. The genetic engineering bacteria provided by the invention are colibacillus pET28a (+)-hSAA1 / Rosetta-gami, which can express soluble target protein. The preparation method of the invention uses a nickel cross-linking affinity-column one-step method, has simple operation, high yield and short consumed time, and is suitable for industrial large-scale production, and the purity of the obtained target protein is larger than 90%.

The invention relates to a vitreoscilla hemoglobin vgbS nucleotide sequence and a plasmid and a preparation method thereof, and belongs to the technical field of biological engineering. The vitreoscilla hemoglobin vgbS nucleotide sequence is prepared by introducing restriction enzyme cutting sites of NdeI and EcoRI at both ends of a vgb nucleotide sequence of streptomyces serving as a host cell respectively. In addition, the plasmid pJTU4406 is generated by cutting off the vgbS nucleotide sequence on pJTU4405 through the NdeI and the EcoRI, and inserting the vgbS nucleotide sequence into corresponding sites of a carrier pIB139. An amino acid sequence of protein expressed and generated by the vgbS nucleotide sequence is totally identical to that of the natural vitreoscilla hemoglobin, and the vitreoscilla hemoglobin vgbS nucleotide sequence can improve the utilization efficiency of the streptomyces to oxygen, promote the growth velocity of thalli and improve the yield of antibiotics.

The invention provides a replicating type recombinant adenovirus HAdV-5 carrier system. The system comprises a framework plasmid pKAd5, an intermediate plasmid pMDXE3YA and a shuttle plasmid pKNXE3M;a target gene coding region is cloned to multiple cloning sites of the shuttle plasmid, EcoRI digests the shuttle plasmid carrying a target gene, and an obtained fragment is used for replacing the corresponding part of the intermediate plasmid; then NdeI is used for digesting the newly-constructed intermediate plasmid, and an obtained fragment is used for replacing the corresponding part of the framework plasmid so as to obtain a recombinant adenovirus plasmid; and the PacI linearized recombinant adenovirus plasmid is used to transfect a 293 cell so as to prepare a recombinant HAdV-5 adenovirus with target gene expression controlled by an HAdV-5 major later promoter (MLP). according to the system, the recombinant adenovirus can be replicated and proliferated in various human cells, is a replicating type virus and is expected to have a wide application prospect in the research and development of animal oral carrier vaccines.

The invention discloses a bacterial strain of producing pyruvic acid and a construction method of the bacterial strain. The construction method comprises the following steps: cloning a D-amino acid oxidase gene DAAO (D Amino Acid Oxidase) into the pUC57 plasmids through EcoRI or BamHI to obtain a plasmid pUC57-DAAO; carrying out gene amplification by taking plasmids pUC57-DAAO as a template; cloning a product obtained by gene DAAO amplification to a plasmid pET28A or pET21a; selecting and culturing positive clone plasmids connected to a DNA segment containing DAAO from the plasmids; converting the constructed positive clone plasmids to an expression host bacterium BL21(DE3); and selecting and culturing to obtain a first bacterial strain which can convert D-alanine to pyruvic acid, wherein the fragment size of the DAAO gene is 1124bp, and the gene contains cleavage sites of endonuclease NdeI and EcoRI. The bacterial strain constructed by the construction method can directly convert D-alanine into pyruvic acid through a biotransfer approach.

The present invention is a new kind of prokaryotic organism non-fusion protein expression carrier constructed by means of DNA recombination technology. The present invention features that mainly pGEMcloning carrier is used as initial plasmid, and the SD sequence of T7 phage gene 10 and T7 terminator sequence are added to the two ends of the polycolonal site, and thus there are various elements of expression carrier. ATG newly introduced to NdeI site provides initial codon ATG for expressing required natural protein. The distance between ATG and the 6-12 base in SD conserved sequence is the optimal distance for efficient initial translation. The recombinant may be selected based on blue-white reaction. The cloning, sequencing and expression of foreign gene may be performed in the same carrier.

The invention discloses a PPK2 protein, and an application of the PPK2 protein as a polyacrylamide gel electrophoresis 35kd standard substance. A ppk2 gene is inserted into a prokaryotic expression vector pET30a by using NdeI and Hind III, the obtained recombinant expression vector is transferred into an Escherichia coli BL21 (DE3) strain through a physical method, IPTG is used to induce trial expression of the target protein PPK2 at 37 DEG C, 25 DEG C and 16 DEG C, and the obtained expression product is identified and analyzed through SDS-PAGE electrophoresis and Western blotting; and finally, amplification culture is carried out by utilizing 3 L of an expression bacterial liquid, and the expression product is separated and purified through a Ni-IDA affinity chromatographic column, an anion exchange chromatographic column and a gel filtration chromatographic column in sequence. Results show that a large intestine prokaryotic expression system can be stably and efficiently expressed under the induction of the IPTG with the temperature of 16 DEG C and the final concentration of 0.2 mM.L<-1>, and the PPK2 protein has the advantages of specific charged property, existence in a monomerform in a solution, stable properties, non-degradability and long half-life period, and has an application prospect as the polyacrylamide gel electrophoresis 35 kd standard substance.

The invention discloses a method for catalytically synthesizing curcumin glycoside compounds by a biological method. A glycosyl transferase gene CaUGT2 and a sucrose synthase gene AtSUS1 are constructed on an expression vector and are introduced into escherichia coli to obtain a recombinant strain, the soluble expression quantity of the recombinant strain after induced expression is improved compared with that of glycosyl transferase from other plants, and a substrate curcumin can be efficiently catalyzed. A recombinant plasmid is pRSF-CaUGT2-AtSUS1, a sucrose synthase AtSUS1 gene is inserted into Nco I and EcoR I, glycosyl transferase CaUGT2 is inserted into Xho I and NdeI, a co-expression recombinant plasmid pRSF-CaUGT2-AtSUS1 is formed, the recombinant plasmid is transformed into escherichia coli BL21 (DE3) competent cells, and a recombinant strain CaUGT2-AtSUS1 is obtained. After the recombinant strain is subjected to induced expression, the soluble expression quantity of the glycosyl transferase CaUGT2 is increased compared with that of glycosyl transferase from other plants, the conversion rate of catalytic synthesis of curcumin glycoside compounds reaches 98%, curcumin is catalyzed to generate curcumin monoglucoside and curcumin diglucoside, the water solubility of the curcumin monoglucoside and curcumin diglucoside is superior to that of curcumin, and the problem that curcumin is poor in water solubility is solved. The concentration of the substrate curcumin is 75 mM, the concentration of a catalytic substrate is relatively high, and the method is more suitable for food and medicine industries in industrialization.

The invention discloses a bioconversion method for anti-AIDS-medicine-reyataz midbody, and belongs to the technical field of medical biology. Secondary structures of genes and codon usage biases are adjusted, the length of primers is controlled within 60 base, the primers are obtained, the obtained primers are dissolved with double distilled water, then the dissolved primers are added into a reaction system, a prepared PCR reaction system is amplified, obtained DNA fragments are subjected to gel cutting purification, and then are cloned into NdeI / XhoI loci of pET30a with a homologous recombination method, a successfully-sequenced DNA sequence is SEQ ID NO.3, and is named as Sst-2, and the corresponding amino acid sequence of the Sst-2 is SEQ ID NO.4. The bioconversion method is mild in reaction condition, and has the low requirement for equipment, the high temperature or cooling is not required in the production process, energy consumption is low, purification is convenient, single enzyme catalysis is used in the whole system, the cycle number of coenzyme is high, and the reaction condition is mild.

The invention belongs to the technical field of gene engineering, and relates to halogenase capable of catalyzing formation of C-F bonds and C-Cl bonds, which is obtained through a gene recombination technology. A preparation method of the halogenase comprises the following steps: by taking a halogenase gene derived from Nocardia brasiliensis as an original gene, optimizing according to codon preference expressed by the halogenase gene in Escherichia coli, thus synthesizing an optimized halogenase gene sequence taking the Escherichia coli as an expression host; recombining the optimized halogenase gene sequence into a cloning vector pUC57 simple, performing NdeI and HindIII double digestion, and connecting to an expression vector pET28a(+) segment having the same endoenzyme site, thus obtaining an expression vector pWHU2401; and converting the expression vector pWHU2401 into an Escherichia coli competent cell to obtain an engineering bacterium capable of heterologously expressing halogenase, performing amplified fermentation, and purifying to obtain the halogenase. According to the invention, the halogenase can specifically synthesize 5'-FDA, and the catalytic activity thereof is equivalent to that of known halogenase FlA. When L-amino acid oxidase is added, the halogenase also can catalyze formation of 5'-ClDA.

The invention relates to a DC (Dendritic Cell) vaccine of a gastric cancer or a breast cancer as well as a preparation method and application thereof. A recombinant overlapped peptide fusion protein is constructed according to an amino acid sequence of a tumor antigen; the overlapped peptide fusion protein consists of polypeptides consisting of 15 amino acids in one series; two adjacent polypeptides have 11 amino acids which are completely overlapped and are the same; overlapped peptides are connected by the same enzyme cutting sites 1i-key; genes of the recombinant overlapped peptide fusion protein are cloned to a pET28 carrier through NdeI and BamH enzyme cutting sites; the recombinant overlapped peptide fusion protein is separated and purified after being expressed through escherichia coli; a PBMC (Peripheral Blood Mononuclear Cell) which is in-vitro separated from human blood, a GM-CSF (Granulocyte-Macrophage Colony-Stimulating Factor) and the recombinant overlapped peptide fusion protein are co-cultured; the recombinant overlapped peptide fusion protein generates a series of uncertain overlapped peptides after DC endocytosis and intracellular digestion, wherein the uncertain overlapped peptides include peptides of CTL (Cytotoxic Lymphocyte) phenotype and / or Th phenotype and are combined into MHC (Major Histocompatibility Complex) I and MHC II molecules of the DC, so that DC is matured to obtain the DC vaccine. Compared with a method for in-vitro synthesizing each peptide stimulating DC, the preparation method disclosed by the invention has quick stimulating DC benefits and low cost.

The invention discloses a prokaryotic promoter reporting system based on a lacZ gene and a pUC replicon. The reporting system comprises the pUC replicon derived from pFLX107, a Cat gene, an rrnbT1T2,a lambda t0 transcription terminator, and the lacZ gene derived from a plasmid pRCL, wherein ClaI, SacI and NdeI sites in the lacZ gene are subjected to silent mutation. The invention further discloses a construction method and application of the prokaryotic promoter reporting system. The size of a plasmid pFGH06 constructed by the invention is 4949 bp; the background activity of the plasmid pFGH06 under a culture condition of 28 DEG C is only 12.2 + / - 0.6, which is remarkably lower than the background activity (21.3 + / - 1.7) of the low-copy reference plasmid pRCL; the plasmid pFGH06 is applied to cloning and activity determination of an inducible promoter araBAD and a constitutive promoter rpsM; and when the plasmid pFGH06 is applied to promoter screening in a simulated mode, 100% recognition of a target promoter can be achieved through blue-white selection.

The present invention discloses a kind of fusion expressed product of vascular inhibine and endosatin in colibacillus and its preparation process, and belongs to the field of genetic engineering and peptide-containing medicine preparation. Through extraction of RNA from liver tissue of animal, RNA reverse transcription, PCR amplification of ES and AS segment and recovering ES and AS segment, and the connection reaction of introducing NdeI, NheI and XholI cleavage site to the primer via the SacI cleavage site in pGEM-T Easy vector to connect vascular inhibine and endosatin, fusion expressed product of vascular inhibine and endosatin in colibacillus is obtained. The fusion expressed product has not only the functions of both vascular inhibine and endosatin but also the synergistic effect of antagonizing angiogenesis and tumor.

The invention discloses a constructing method of a plant expression vector containing a green fluorescence protein reporter gene. The constructing method comprises the following steps: using a pRI-AN-101 vector as a skeleton vector, amplifying the GFP full-length gene sequence on a pCXGFP-P vector by a PCR technology, inserting the GFP full-length gene forward sequence into the pRI-AN-101 vector to obtain a recombinant vector pRI-AN-101-GFP, performing site-specific mutagenesis on NdeI recognition sites in the GFP full-length gene sequence to cause the NdeI to be used for double digestion when the plant expression vector is constructed, and finally obtaining the plant expression vector containing the GFP gene, namely pRI101-GFP. The green fluorescence protein reporter gene contained in the vector can identify transgenic plants quickly and conveniently.

The invention discloses a preparation method of a pig alpha-interferon compound preparation. The preparation method comprises the steps as follows: (1) artificially synthesizing a small and short lactic acid bacillus signal peptide sequence of 150 bp and creating a pUCK-SP carrier; (2) creating pUCK-SP-IFN-alpha plasmids, carrying out enzyme digestion on the pUCK-SP-IFN-alpha plasmids through NdeI and EcoRI, and recovering an SP-IFN-alpha fragment; (3) creating lactobacillus casei replicate type expression plasmids pIAbeta8-plac-SP-IFN-alpha; and (4) obtaining the pig alpha-interferon compound preparation through an electric conversion method. According to the preparation method, a pig IFN-alpha gene is planned to be guided into lactobacillus casei so as to obtain lactobacillus casei capable of expressing pig IFN-alpha. A bacterial strain integrates the effects of virus resistance and bacteria resistance and can be very conveniently fed to animals in an oral administration way.

The invention discloses a PPK2 protein and application thereof as a 30kd standard substance for polyacrylamide gel electrophoresis. Ppk2 genes are inserted into a prokaryotic expression vector pET30aby virtue of NdeI and HindIII, a recombinant expression vector is transferred into an escherichia coli BL21(DE3) strain by virtue of a physical method, a target protein PPK2 is induced to realize trial expression at 37 DEG C, 25 DEG C and 16 DEG C by virtue of IPTG, and an expression product is authenticated and expressed by virtue of SDS-PAGE electrophoresis and Western Blotting; and finally, amplification culture is carried out by virtue of 3.2L of expression bacteria liquid, and the expression product is sequentially separated and purified by virtue of Ni-IDA affinity chromatography, cation-exchange chromatography and gel filtration chromatography. A result shows that a large intestine prokaryotic expression system can be induced to realize stable and efficient expression by virtue of the IPTG with a final concentration of 0.2mM.L<-1> at 16 DEG C, the PPK2 protein has an exclusive charging property, stable performance and a long half-life period, exists in a solution in a monomer manner, is unlikely to degrade and has an application prospect as the 30kd standard substance for the polyacrylamide gel electrophoresis.

The invention discloses a recombinant bacterium and application of the recombinant bacterium to preparation of rebaudioside M2 by catalyzing rebaudioside A. The recombinant bacterium contains a tomato-based glycosyltransferase UGTSL2 gene and a potato-based sucrose synthase StSUS1 gene at the same time; the tomato-based glycosyltransferase UGTSL2 gene is cloned between NdeI and XhoI sites of pRSFDuet-1 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2; then the potato-based sucrose synthase StSUS1 gene is cloned between NcoI and EcoRI sites of the pRSFDuet-SL2 and is constructed to obtain a recombinant plasmid pRSFDuet-SL2-SUS1; the recombinant plasmid pRSFDuet-SL2-SUS1 is transferred into a host cell to obtain the recombinant bacterium. After the recombinant bacterium is subjected to induced expression, crude enzyme liquid is taken and is added into a reaction mixture to catalyze the rebaudioside A to generate the rebaudioside M2; in a reaction process, the crude enzyme liquid obtained by crushing the recombinant bacterium is utilized and separation and purification of an enzyme are avoided; lyophilized powder is also not needed and substrates including rebaudioside D and UDP or UDP-glucose and any cell penetration agent or other chemical reagents do not need to be added, so that the environmental friendliness is better. The yield of the rebaudioside M2 reaches 11.09g / L.

The invention discloses a construction method and application of strains of an over-expression Tm-AHAS-CSU. The construction method of the recombination strains includes the steps that according to the gene sequence of the Tm-AHAS-CSU, upstream and downstream primers are designed, the designed upstream primer carries NdeI restriction enzyme cutting sites, the designed downstream primer carries BamHI restriction enzyme cutting sites, and then with thermotoga maritime genome DNA being a template, a target gene fragment is obtained through a PCR amplification technology; the target gene fragment is connected to an expression carrier pET28a to obtain recombined plasmids pET28a-TmAHAS-CSU, and the recombined plasmids are transformed into competent cells through a thermal shock method to construct the recombination strains of over-expression Tm-AHAS-CSU proteins. On the basis, the function of the recombination strains and the application of the recombination strains in the aspects of selectively synthesizing R-PAC and other analogues in a three-dimensional and catalyzed mode are verified.

Belonging to the technical field of goat genetic marker preparation, the invention in particular relates to a molecular marker related to goat growth traits and application thereof. The molecular marker is obtained by cloning of a sixth intron sequence of a goat TR alpha gene, and the nucleotide sequence of the gene is shown as a sequence table SEQ ID NO:1. Base mutation of C230-T230 occurs at a 230th base of the sequence shown as the sequence table SEQ ID NO:1, and results in NdeI-RFLP polymorphism. The invention also discloses a preparation method of the molecular marker and application of a polymorphic detection method, and provides a new genetic marker for marker assisted selection of goat.

The invention relates to the fields of molecular biology and immunology, in particular to a vibrio harveyi secretory type vaccine and a structure and application thereof. Particularly, the secretory type vaccine is a base sequence in a sequence table SEQ ID No.1, and the construction process thereof is as follows: utilizing vibrio harveyi T4 as a template and F11 and R8 as primers for PCR amplification, connecting the product with pBS-T at room temperature, utilizing NdeI / XhoI double-enzyme cleavage to recover 1.2kb segment from plasmids pBSVhP1, simultaneously utilizing NdeI / XhoI double-enzyme cleavage to recover 4.3kb segment of plasmids pBT3, connecting the two segments at room temperature by ligase T4DNA for 2-4h, transforming connection liquid into colon bacillus DH5 alpha, culturingon an LB solid medium containing Ap for 24h to screen out white transformant, i.e. the Vibrio harveyi secretory type vaccine of base sequence in the expression sequence table SEQ ID No.1. The obtained vaccine has immune and protective functions on Vibrio harveyi. The obtained vaccine has the immune and protective effects on the Vibrio harbeyi, and the immune and protective efficiency of the vaccine of the invention on the Vibrio harveyi can reach to 90%. The preparation process is simple, devitalization and other steps do not needed, and no adjuvant is needed.

The invention relates to the technical field of potassium ion channel regulatory proteins, in particular to a recombinant vector, an expression vector, a genetically engineered bacterium and application thereof. The recombinant vector is obtained by inserting a DNA (Deoxyribose Nucleic Acid) sequence as shown in SEQ ID NO.1 between NruI and NdeI sites of a pPrey-PartnerSUS-2in1-Dest vector, and is named as pKY2in1-Dest, and the expression vector is obtained by transferring a potassium channel gene and other regulatory protein genes into the pKY2in1-Dest in one step through Gateway cloning reaction. The genetically engineered bacterium is obtained by transferring the expression vector into a recipient bacterium. The genetically engineered bacterium can be applied to large-scale screening of regulatory proteins affecting the potassium absorption function of the potassium ion channel, influences on the potassium channel function are directly shown by observing yeast growth under a low-potassium condition, and the genetically engineered bacterium has the advantages of being simple in condition, low in cost and short in experimental period.

The invention discloses an expression vector of membrane protein YddG and an expression and purification method of the membrane protein YddG. The nucleotide sequence of the expression vector is shown as SEQ ID NO.2, and the expression vector comprises a phage T7 promoter; an escherichia coli ribosome binding site, which comprises an NcoI sequence CCATGG, an escherichia coli membrane protein YddG sequence as shown in SEQ ID NO. 1, and a BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; an NdeI enzyme cutting site CATATG; a super-folded Venus fluorescent protein coding sequence; an XhoI enzyme cutting site is CTCGAG; and 6 histidine sites and a termination codon TAG. According to the present invention, a fluorescent protein with molecular rigidity is used as a selection marker and an expression process indicator, and the fluorescent protein can be quickly folded due to a molecular level rigid structure, so as to help the nitrogen-terminal membrane protein YddG stabilize the conformation of the nitrogen-terminal membrane protein YddG. The expression vector constructed by the invention can realize mass expression of the membrane protein YddG, and can be used for high-throughput screening of subsequent novel antibiotics.

The invention provides a recombinant vector CTE528, and a construction method and application thereof, and belongs to the field of gene engineering. The invention provides a vector system construction method capable of being efficiently used in dunaliella salina gene engineering by aiming at the defect that research of microalgae transgenosis mostly focuses on mode algae Chlamydomonas reininhardtii. The vector system construction method comprises the following steps of: after NdeI is added to two sides of a CAT gene, cloning the CAT gene to a pBI221-GFP vector to serve as an intermediate vector CTE527, splicing Ubi and Omega, adding Sse8387I / BamH I to two sides, and cloning the Sse8387I / BamH I to the CTE527.

The present invention provides a methylation protected host bacterium and a construction method and an application thereof. An amino acid sequence of a transmethylase is shown in SEQ ID NO:1 and a nucleotide sequence of the transmethylase is shown in SEQ ID NO:2, the host strain is transformed with a methyltransferase expression vector which realizes a methylation protection function of host bacterium genomic DNA and avoids a cleavage effect of NdeI on host DNA, and the methylation protected host bacterium can be used for expressing a variety of restriction endonucleases including NdeI.

The invention discloses an enhanced polysaccharide antigen immunogenic protein carrier as well as a preparation method and application thereof. A CRM197A gene sequence and a Hin47 gene sequence are taken as templates, and a fusion gene is obtained by over-lap PCR (polymerase chain reaction) amplification; after being subjected to double-enzyme digestion of BamHI and NdeI, the fusion gene and a pET 9a expression carrier are connected by T4 ligase; after successful connection is confirmed by enzyme digestion, CRM197A-Hin47 fusion protein is obtained by means of IPTG inducible expression and purification. Haemophilus influenzae type b capsular polysaccharide PRP and the fusion protein are coupled by a CDAP / CNBr or reduction amine method, and a prepared conjugate of the PRP and the fusion protein can be used for preparing a conjugate vaccine for preventing haemophilus influenzae type b. Experiments prove that when the fusion protein is taken as a protein carrier of a polysaccharide conjugate vaccine, the immunogenicity of polysaccharide antigen can be remarkably enhanced; furthermore, vaccines which are developed based on the protein carrier provided by the invention can effectively reduce the immune interference caused by currently using a great deal of same protein carriers, so that the development of combined vaccines and polyvalent vaccines is facilitated.

The invention discloses a method and a kit for detecting a genotype of rs1801394 polymorphic locus of an MTRR gene. According to the method, the genotype of the rs1801394 locus of the MTRR gene is detected by a PCR-RFLP method; a PCR product carries an internal control restriction enzyme cutting site of NdeI or an isoschizomer thereof; a rapid restriction endonuclease is used for digestion of thePCR product to obtain a restriction map for genotyping, so that a typing time can be shortened; meanwhile, results can be comprehensively judged according to residual PCR products, residual digestionintermediate products and characteristic strips of each genotype sample after complete digestion so as to avoid genotype misjudgment caused by incomplete digestion of traditional methods.

The invention discloses an expression vector of a membrane protein AmtB and an expression and purification method of the membrane protein AmtB. The nucleotide sequence of the expression vector is shown as SEQ ID NO.2, and the expression vector comprises a phage T7 promoter; an escherichia coli ribosome binding site, which comprises an NcoI sequence CCATGG, an escherichia coli membrane protein AmtB sequence as shown in SEQ ID NO. 1, and a BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; an NdeI enzyme cutting site CATATG; a super-folded Venus fluorescent protein coding sequence; an XhoI enzyme cutting site is CTCGAG; and 6 histidine sites and a termination codon TAG. According to the present invention, a fluorescent protein with molecular rigidity is used as a selection marker and an expression process indicator, and the fluorescent protein can be quickly folded due to a molecular level rigid structure, so as to help the nitrogen-terminal membrane protein AmtB stabilize the conformation. The expression vector constructed by the invention can realize mass expression of the membrane protein AmtB, and can be used for high-throughput screening of subsequent novel antibiotics.