Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vibrio harveyi secretory type vaccine and construction method thereof

A technology of Vibrio harveyi and its construction method, which is applied in the fields of molecular biology and immunology, can solve the problems of unreported application of secretory vaccines, use restrictions, and antibiotic hazards, and achieve high protection rate, strong immune effect, and low cost. cheap effect

Inactive Publication Date: 2012-01-11
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of antibiotics has gradually been restricted internationally due to their potential hazards to the environment and human health
Vaccines against Vibrio harveyi are mainly simple inactivated vaccines, and the application of secreted vaccines has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] The vibrio harveyi secreted vaccine is shown in the base sequence of SEQ ID No.1 in the sequence table. Sequence listing SEQ ID No1

[0025] ATGTTAAAAGAAACTACTAAGTTGTTGTATCACCTCGGCACTCTGTTTCCATTCTTCTCTCGCTTTTTCGCAATCGACAGA

[0026] ACTCCCAAATGATGCGGATTTAGCGCAGACACCTGCGTCACTGATGCTTGCGCCTGAAGACGTCGCCATCGCTGATCGTT

[0027] ATATCGTTGTATTTCATCAACTCAAATGATGATGAATAATTCACTTGAATTACAGCAGTTCACACAACAATCTGTGGAC

[0028] CGAATGTCTGGTTTGTACTCAATAGAAGTGGAATCAGTATTCGACAATTCGATCAGCGGTTTCGTTGCGACGTTAGCTCC

[0029] TGAACAGCTGAAAGCGTTACGTGCTGATCCACGTGTTGAATACATCGAGCAAGACAGAATTCTTACACTAGACCCAATAG

[0030] TCTCGGCAGAAGTAAACCAAAGTAATGCAATTTGGGGGCTAGACCGAATTGATCAACGTAGTCTGCCTCTCAATAACAAT

[0031] TACAGCGCCAACTTTGATGGAACGGGCGTCACGGCTTACGTTATCGATACGGGTGTGAACAACTCGCACGTTGAATTTGC

[0032] CGGACGCTCCATTTCGGGATATGACTTTGTCGACAATGATGCGGATGCCAGTGACTGTAATGGACACGGCACACACGTAG

[0033] CGGGCACGATCGGCGGATCTTTGTATGGCGTGGCAAAGAACGTGAGCATTGTTGGTGTCAGAGTGCTTAGCTGTTCTGGC

[0034] TCAGGTTCAACGTCCGGCGTTATTGC...

Embodiment 2

[0061] Vaccine bacterial suspension: culture the Vibrio harveyi secretory vaccine strain DH5α / pTVP1M containing the nucleotide sequence in the sequence table SEQ ID No.1 obtained above in LB liquid medium containing 50ug / ml Ap overnight; Add 0.1ml of the overnight culture solution into 10ml of fresh LB liquid medium containing Ap (50ug / ml), and culture at 28°C with shaking at 160rpm until OD 600 0.8-1, then the bacterial culture solution was centrifuged (5000g, 4°C, 10min), and the bacterial cells were collected and suspended in PBS to a final concentration of 4×10 8 cfu / ml is the vaccine preparation solution.

[0062] Vaccine control solution: The plasmid pBT3 was transformed into DH5α by the Hanahan method to obtain the transformant DH5α / pBT3. Cultivate DH5α / pBT3 overnight in LB liquid medium containing 50ug / ml Ap; take 0.1ml of overnight culture solution, add it to 10ml of fresh LB liquid medium containing Ap (50ug / ml), at 28 Shake culture at 160rpm at ℃ to OD 600 0.8-1,...

Embodiment 3

[0065] Immunization injection of the above-mentioned vaccine bacteria suspension: 80 flounder (each weighing about 10 g) were randomly divided into 2 groups, 40 in each group. These two groups are named A and B respectively. Each fish in Group A was injected intraperitoneally with 100ul of the vaccine bacteria suspension, and each fish in Group B was injected intraperitoneally with 100ul vaccine control solution. After 20 days, each fish in group A was injected intraperitoneally with 100ul of the vaccine bacteria suspension again, and each fish in group B was injected with 100ul vaccine control solution intraperitoneally.

[0066] Preparation of Vibrio harveyi suspension: culture Vibrio harveyi from T4 to OD in LB medium 600 0.6, and then centrifuged (5000g, 4°C, 10min). Collect the cells and suspend them in PBS to a final concentration of 8×10 7 cfu / ml is Vibrio harveyi suspension.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the fields of molecular biology and immunology, in particular to a vibrio harveyi secretory type vaccine and a structure and application thereof. Particularly, the secretory type vaccine is a base sequence in a sequence table SEQ ID No.1, and the construction process thereof is as follows: utilizing vibrio harveyi T4 as a template and F11 and R8 as primers for PCR amplification, connecting the product with pBS-T at room temperature, utilizing NdeI / XhoI double-enzyme cleavage to recover 1.2kb segment from plasmids pBSVhP1, simultaneously utilizing NdeI / XhoI double-enzyme cleavage to recover 4.3kb segment of plasmids pBT3, connecting the two segments at room temperature by ligase T4DNA for 2-4h, transforming connection liquid into colon bacillus DH5 alpha, culturingon an LB solid medium containing Ap for 24h to screen out white transformant, i.e. the Vibrio harveyi secretory type vaccine of base sequence in the expression sequence table SEQ ID No.1. The obtained vaccine has immune and protective functions on Vibrio harveyi. The obtained vaccine has the immune and protective effects on the Vibrio harbeyi, and the immune and protective efficiency of the vaccine of the invention on the Vibrio harveyi can reach to 90%. The preparation process is simple, devitalization and other steps do not needed, and no adjuvant is needed.

Description

technical field [0001] The invention relates to the fields of molecular biology and immunology, in particular to a vibrio harveyi secreted vaccine and its construction and application. Background technique [0002] Vibrio harveyi (Vibrio harveyi) is an important pathogenic bacteria in aquaculture, which can infect a variety of aquaculture animals, including fish, shrimp, and shellfish. The current prevention and control of Vibrio harveyi relies on antibiotics and immune control. Due to the potential hazards of antibiotics to the environment and human health, their use has gradually been restricted internationally. Vaccines against Vibrio harveyi are mainly simple inactivated vaccines, and the application of secreted vaccines has not been reported. Contents of the invention [0003] The purpose of the present invention is to provide a vibrio harveyi secretory vaccine and its construction and application. [0004] To achieve the above object, the technical solution adopte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C12N1/21A61K39/108A61P31/04
Inventor 孙黎程爽张卫卫
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com