66 results about "Muscovy duck parvovirus" patented technology

The invention discloses a GeXP (Gene Expression Profiler) detection kit for differentiating 11 kinds of duck viral diseases. The invention provides a GeXP detection primer group for identifying or assisting to identify duck infectious disease pathogens, wherein the primer group consists of a primer pair A, a primer pair B, a primer pair C, a primer pair D, a primer pair E, a primer pair F, a primer pair G, a primer pair H, a primer pair I, a primer pair J, a primer pair K and a primer pair L. According to the GeXP detection kit, shown by experiments, the primer group, a PCR (Polymerase Chain Reaction) reagent and the primer pairs, provided by the invention, are used for simultaneously differentiating and detecting avian influenza viruses, H5, H7 and H9 subtype avian influenza viruses, duck hepatitis viruses, duck plague viruses, duck flaviviruses, newcastle disease viruses, egg drop syndrome viruses, muscovy duck reoviruses, muscovy duck parvoviruses and duck circoviruses and are good in specificity and high in sensitivity. The detection kit, which is simple and convenient and is high in flux, and a detection system are provided for the detection on common major duck infectious disease pathogens, so that the practical needs are better met, and application prospects are broad.

The invention aims to provide a Muscovy duck parvovirus. The Muscovy duck parvovirus is a YBMDV strain, and is preserved in the China General Microbiological Culture Collection Center of the China Committee Of Culture Collection For Microorganisms in the Institute of Microbiology Chinese Academy of Science at the address of No. 3, No. 1 yard, Beichen west road, Chaoyang District, Beijing, on November 11th, 2013; the preservation number is CGMCC No. 8504. The Muscovy duck parvovirus screened by the invention has the characteristics of low toxicity and high immunogenicity; dead embryo and embryo liquid can be obtained by vaccinating the Muscovy duck parvovirus to a Muscovy duck embryo; virus liquid can be collected after grinding and freeze thawing; a vaccine is prepared by ultrafiltration concentration, formalin inactivation, the addition of an adjuvant, and mixing and emulsification; the Muscovy duck parvovirus can improve antibody of the Muscovy duck, ensure parent source antibody level of an offspring, and prevent green duck parvovirus infection caused by Muscovy duck parvovirus; the vaccine has the advantages of high efficiency and good safety.

Provided herein is a GeXP detection kit for identification of 11 kinds of duck virus diseases. The detection kit includes a primer set for identifying or auxiliarily identifying pathogens of duck communicable diseases, including one or more of primer pair A, primer pair B primer pair C, primer pair D, primer pair E, primer pair F, primer pair G, primer pair H, primer pair I, primer pair J, primer pair K and primer pair L. The can kit detect, simultaneously avian influenza virus, subtype H5, H7 and H9 of avian influenza virus, duck hepatitis virus, duck enteritis virus, duck Tembusu virus, Newcastle disease virus, egg drop syndrome virus, Muscovy duck reovirus, Muscovy duck parvovirus and duck circovirus with the primer set, PCR reagent or primer pairs provided in the present invention.

The invention discloses a primer pair group and a kit for performing identification or auxiliary identification on duck-related viruses and application of the primer pair group and the kit. The primer pair group consists of three primer pairs, and the three primer pairs consist of two single-stranded deoxyribonucleic acids (DNA) which are shown as a sequence 1 and a sequence 2, a sequence 3 and asequence 4, and a sequence 5 and a sequence 6 respectively; and the duck-related viruses are at least one of Muscovy duckling parvovirosis, duck circoviruses and duck hepatitis virus type I. A triplepolymerase chain reaction (PCR) technology that three kinds of pathogens, namely the Muscovy duckling parvovirosis, the duck circoviruses and the duck hepatitis virus type I can be simultaneously detected and identified through one-time PCR is established, and has the advantages of high specificity and sensitivity (the lowest detection line is 1pg), low cost, high efficiency and the like; and moreover, an amplification result is directly determined by utilizing the difference of the length of amplified fragments in the aspect of primer design, so that the method is relatively simple, convenient, intuitive and practical during result determination.

The invention provides a preparation method of a goose parvovims and muscovy duckling parvovirus bivalent egg yolk antibody. According to the technical scheme, an inactivated vaccine prepared from a goose parvovims GPV-HB strain and a market sold goose parvovims live vaccine are jointly used as a goose parvovims antigen; an inactivated vaccine prepared from muscovy duckling parvovirus MDPV-FJ strains is singly used as a muscovy duckling parvovirus antigen; the immune is totally performed for three times; the basic immune of the goose parvovims live vaccine and the self-made goose parvovims inactivated vaccine is performed once; the reinforced immune is performed twice; the interval between every two times is three weeks; the dose is 1ml / individual for each kind of vaccine in each time; theimmune times and the interval of the muscovy duckling parvovirus are identical to those of the goose parvovims, but the immune time is delayed for one week through being compared with that of the goose parvovims; the immune dose is 1ml / individual. Through the antigen and the immune measures, the valence of two antibodies in high-immunity eggs can reach the relatively high level. The egg yolk antibody prepared by the method provided by the invention can realize the simultaneous prevention and treatment on goose parvovims and muscovy duckling parvovirus diseases; the protection rate is very high.

The invention discloses a triple fluorogenic quantitative PCR detection primer, kit and method of the duck tembusu virus disease, the egg drop syndrome virus and the H9 subtype avian influenza virus. The detection primer for the duck tembusu virus disease, the egg drop syndrome virus and the H9 subtype avian influenza virus is shown in SEQ ID NO.1-6. The detection primer and kit can detect the EDSV, the H9 AIV and the DTMUV at the same time. No cross reaction with duck plague virus, goose parovovirus, muscovy duck parvovirus and escherichia coli genomic DNA and duck hepatitis A virus 1, duck hepatitis A virus 3, muscovy duck reovirus and newcastle disease virus RNA exists. The lower limits of detection for EDSV nucleic acid, H9 AIV nucleic acid and DTMUV nucleic acid are 8.0 copies, 4.8 copies and 1.3 copies respectively. The detection primer, kit and method can be used for qualitative and quantitative detection for the EDSV, the H9 AIV and the DTMUV.

The invention provides a muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer and method. The MDPV primer sequence is as follows: anupstream primer P1: TAATGGTGGCAGGAATGCACAGTTC, and a downstream primer P2: TGTTACCATGATGTCTGAAAT; the GPV primer sequence is as follows: an upstream primer P3: GAGGTAGACAGCAACAGAAA, and a downstream primer P4: GCTCGTCCGTGACCATA. Relevant research reports and invention patents about the dual real-time fluorescence quantitative PCR detection primer and method based on SYBR Green II capable of completely distinguishing all gene subtypes of GPV from MDPV are unavailable at present; the MDPV and GPV dual real-time fluorescence quantitative PCR detection primer and method provided by the invention appear for the first time in the relevant fields.

The invention discloses a method for identifying new goose parovovirus. The fluorescent quantitation PCR detection method is high in flexibility and capable of detecting 10 copy number of gene of thenew goose parovovirus while an ordinary PCR only can detect 104 copy number, and the flexibility is higher 1000 times; the specificity is high, according to the difference region between classic gooseparovovirus and the new goose parovovirus and the difference region between muscovy duck parvovirus and the new goose parovovirus, a pair of specificity primers are designed and synthesized, and thegene fragments of the new goose parovovirus can be specifically amplified; the repeatability is high, analysis can be accurately and quickly conducted, and application and popularization in clinical practices are facilitated.

The invention discloses a method for establishing goose embryo epithelial cell line and the established goose embryo epithelial cell line. The invention relates to the method for establishing the goose embryo epithelial cell line, which is characterized in that a primary goose tissue adherent method, a differential velocity enzymatic digestion and a monoclonal screening method are combined, so that primary culture condition can be optimized. The method has the advantages of simple operation process, and convenient popularization and application. The invention also relates to the goose embryo epithelial cell line established by the method, a preservation number of the goose embryo epithelial cell line is CCTCC NO: C2014137, The establishment of the goose embryo epithelial cell line solves the problem of no well-established goose source cell line in prior art. The invention also relates to a kit used for culturing and / or proliferating goose parvovirus, muscovy duck parvovirus and type I duck hepatitis virus and novel duck hepatitis virus, and is characterized in that a host cell to be infected is / or comprises the goose embryo epithelial cell line. The method for establishing the goose embryo epithelial cell line verifies the sensitive characteristic of the goose parvovirus, muscovy duck parvovirus and type I duck hepatitis virus and novel duck hepatitis virus.