Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer

A real-time fluorescence quantification and Muscovy duck parvovirus technology, which is applied in the determination/testing of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of misjudgment as MDPV, etc., and achieve strong specificity and high sensitivity , good repeatability

Inactive Publication Date: 2018-05-08
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the new gene subtype GPV (MDGPV) popular in Muscovy duck populations in my country in recent years, which has high homology with classic GPV and MDPV, it is often misidentified when using the existing dual fluorescent quantitative PCR method. MDPV
At present, there is no set of dual fluorescence quantitative PCR detection primers and methods that can completely distinguish various genotypes of GPV from MDPV at the same time. The establishment of the present invention can fill in the gaps in related fields

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer
  • Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer
  • Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0017] 1.1 Materials

[0018] 1.1.1 Virus strains

[0019] Muscovy duck parvovirus (MDPV), goose parvovirus including classic GPV-SG strain (GPV1), MDGPV PT strain (GPV2) and SBDS-GPV M15 strain (GPV3), new duck reovirus (NDRV), Muscovy duck reovirus Orphan enterovirus (MDRV), duck hepatitis virus (DHV), duck plague virus (DPV) and goose paramyxovirus (PMV) were isolated, identified and preserved by our laboratory; egg drop syndrome virus (EDSV) was purchased from China Veterinary Medicine Surveillance Office; Viral DNA was extracted by conventional methods.

[0020] 1.1.2 Main instruments and reagents

[0021] SYBR ® Premix Ex Taq TM (Tli RNaseH Plus), pMD19-T vector was purchased from Bao Biological Engineering (Dalian) Co., Ltd., DNase / RNase-Free deionized water (RT121) was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Ezup column virus DNA extraction The extraction kit was purchased from Sangon Bioengineering (Shanghai) Co., Ltd.; the fluorescen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) dual real-time fluorescence quantitative PCR detection primer and method. The MDPV primer sequence is as follows: anupstream primer P1: TAATGGTGGCAGGAATGCACAGTTC, and a downstream primer P2: TGTTACCATGATGTCTGAAAT; the GPV primer sequence is as follows: an upstream primer P3: GAGGTAGACAGCAACAGAAA, and a downstream primer P4: GCTCGTCCGTGACCATA. Relevant research reports and invention patents about the dual real-time fluorescence quantitative PCR detection primer and method based on SYBR Green II capable of completely distinguishing all gene subtypes of GPV from MDPV are unavailable at present; the MDPV and GPV dual real-time fluorescence quantitative PCR detection primer and method provided by the invention appear for the first time in the relevant fields.

Description

technical field [0001] The invention belongs to the field of preventive veterinary medicine, and relates to double real-time fluorescent quantitative PCR detection primers and methods for Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV), in particular to multiple SYBR Green II real-time fluorescent quantitative PCR methods for MDPV and GPV Primers and methods. Background technique [0002] Muscovy duck parvovirus (MDPV) is the pathogen that causes muscovy duck blight (commonly known as "three-week disease") with diarrhea, soft feet and dyspnea as the main symptoms in young muscovy ducks. The incidence of Muscovy ducks is 27% to 62%, and the fatality rate is 22% to 43%. It is an important pathogen that endangers Muscovy duck breeding. The disease was first isolated and identified in the world by Cheng Youquan, a Chinese scholar, in 1988, and then France, the United States, Japan and other places reported the prevalence of the disease one after another. [0003] Gos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/701C12Q2561/113C12Q2563/107C12Q2545/114C12Q2537/143C12Q2527/107
Inventor 林甦陈少莺王劭黄梅清程晓霞俞博肖世峰
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More