A chicken intestinal tract Beta-defensin cDNA is characterized in that the cDNA has the following sequence: TCAGACAGCCAGCTGTGCAG GAACAACCAT GGCCACTGCC GGAGGCTCTG CTTCCACATGGAGAGCTGGG CTGGGAGCTGCATGAACGGC CGCCTGCGCT GCTGCAGGTTCTCCACCAAG CAGCCCTTTT CCAACCCTAA ACATTCAGTG CTGCACACAGCAGAGCAGGA CCCTTCCCCA AGCCTTGGAG GGACGTGA. The amino acid sequence of the Beta-defensin is Ser-Asp-Ser-Gln-Leu Cys-Arg-Asn-Asn-His Gly-His-Cys-Arg- Arg Leu-Cys-Phe-His-Met Glu- Ser-Trp-Ala-Gly Ser-Cys-Met-Asn-Gly Arg-Leu-Arg-Cys-Cys Arg-Phe-Ser-Thr-Lys-Gln Pro-Phe-Ser-Asn-Pro Lys-His-Ser-Val-Leu His-Thr-Ala-Glu-Gln Asp-Pro-Ser-Pro-Ser Leu-Gly-Gly-Thr. The extraction method comprises the following steps of: (A) collecting broken mucosa cells of chicken intestinal tract; (B) breaking vesicles; (C) leaching with 5% acetic acid under stirring, centrifuging, collecting supernatant, removing sediment, subpackaging the supernatant and freeze-storing to obtain crude chicken intestinal tract Beta-defensin; (D) separating the supernatant with Sephadex G-100 gel column at low temperature, eluting with 0.2mol / L sodium acetate (constant flow pump speed 3*1), detecting with nucleic acid-protein detector, collecting the eluate with an automatic collector (1.5mL each tube), and recording with a recorder (speed 6cm / h, and range 20mV); (E) detecting the antibacterial activity of the liquid in each tube to Pasteurella with agarose diffusion method, collecting the eluate with bacteriostatic activity, and storing under vacuum freeze drying; (F) purifying the the eluate with bacteriostatic activity with Tricine-PAGE, PVDF membrane blotting the protein bands, and performing amino acid sequence analysis with Sanger partial hydrolysis method; and (G) deriving chicken intestinal tract Beta-defensin cDNA with BLAST software.