Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

35 results about "Amino acid sequence analysis" patented technology

Amino acid sequence analysis is useful for the study of problems ranging from modifications of single molecules to complex networks and interactions of species.

Casein active single peptide as well as preparation method and application thereof

The invention provides casein active single peptide as well as a preparation method and application thereof. An amino acid sequence is Asn-Pro-Ser-Lys-Glu-Asn-Leu. In the invention, a modern catalysis technology is used for enzymolysis, a part with strong activity for prompting yogurt fermentation and inhibiting the yogurt post-acidification is separated and purified by using a biological molecule separation and purification technology, and amino acid sequence analysis is performed for the active single peptide obtained by purifying. The active peptide has the functions of obviously shortening the yogurt fermentation time and inhibiting the yogurt post-acidification, and can be safely added into the yogurt; thereby the biological active peptide is used as yogurt fermentation addictive to improve the quality of the yogurt product.
Owner:SOUTH CHINA UNIV OF TECH

Rapid detection test strip for BVDV (bovine viral diarrhea virus) antibody and preparation method thereof

The invention discloses a recombinant antigen for BVDV (bovine viral diarrhea virus) antibody detection and a rapid detection test strip thereof, mainly aiming at a truncated BVDV NS expression antigen for BVDV antibody detection and a rapid detection test strip for detecting BVDV antibodies. A BVDV NS protein amino acid sequence is analyzed by utilizing epitope analysis software; a fragment with the main epitope is taken; a truncated BVDV NS recombinant antigen is obtained according to the corresponding nucleotide sequence design primer through PCR (polymerase chain reaction) amplification, recombination expression carrier construction and prokaryotic expression, and can be used for BVDV antibody detection after being purified. The rapid detection test strip established based on the truncated BVDV NS antigen has the advantages of convenience in operation, rapid detection, no requirement of a special laboratory and equipment and the like, overcomes the limits of the existing detection method, and can be used for rapid detection and serum epidemiological investigation of the BVDV antibodies.
Owner:SHENZHEN AUDAQUE DATA TECH

Human protein phosphokinase 2A point mutanted lung cancer related antigen gene

A human protein phosphatase site-2A alpha mutant gene sequence associated with lung cancer, the change from arginine to tryptophane in the polypeptide chain whose amino acid sequence is shown by SEQ ID No.2, and the process for preparing said DNA sequence are disclosed, which can be used for diagnosing and treating lung cancer.
Owner:昆明医学院第一附属医院

Amino acid sequence and polynucleotide sequence for chicken intestinal canal beta alexin and extraction method thereof

A chicken intestinal tract Beta-defensin cDNA is characterized in that the cDNA has the following sequence: tcagacagcc agctgtgcag gaacaaccat ggccactgcc ggaggctctg cttccacatg gagagctggg ctgggagctg catgaacggc cgcctgcgct gctgcaggtt ctccaccaag cagccctttt ccaaccctaa acattcagtg ctgcacacag cagagcagga cccttcccca agccttggag ggacgtga. The amino acid sequence of the Beta-defensin is Ser-Asp-Ser-Gln-Leu Cys-Arg-Asn-Asn-His Gly-His-Cys-Arg- Arg Leu-Cys-Phe-His-Met Glu- Ser-Trp-Ala-Gly Ser-Cys-Met-Asn-Gly Arg-Leu-Arg-Cys-Cys Arg-Phe-Ser-Thr-Lys-Gln Pro-Phe-Ser-Asn-Pro Lys-His-Ser-Val-Leu His-Thr-Ala-Glu-Gln Asp-Pro-Ser-Pro-Ser Leu-Gly-Gly-Thr. The extraction method comprises the following steps of: (1) collecting broken mucosa cells of chicken intestinal tract; (2) breaking vesicles; (3) leaching with 5% acetic acid under stirring, centrifuging, collecting supernatant, removing sediment, subpackaging the supernatant and freeze-storing to obtain crude chicken intestinal tract Beta-defensin; (4) separating the supernatant with Sephadex G-100 gel column at low temperature, eluting with 0.2mol/L sodium acetate (constant flow pump speed 3*1), detecting with nucleic acid-protein detector, collecting the eluate with an automatic collector (1.5mL each tube), and recording with a recorder (speed 6cm/h, and range 20mV); (5) detecting the antibacterial activity of the liquid in each tube to Pasteurella with agarose diffusion method, collecting the eluate with bacteriostatic activity, and storing under vacuum freeze drying; (6) purifying the the eluate with bacteriostatic activity with Tricine-PAGE, PVDF membrane blotting the protein bands, and performing amino acid sequence analysis with Sanger partial hydrolysis method; and (7) deriving chicken intestinal tract Beta-defensin cDNA with BLAST software.
Owner:HENAN AGRICULTURAL UNIVERSITY

Acipenser sinensis antibacterial peptide and preparation method and application thereof

The invention discloses an acipenser sinensis antibacterial peptide and a preparation method and an application thereof, and particularly discloses a novel acipenser sinensis natural antibacterial peptide pen-hepcidin, an amino acid sequence for encoding a gene and an application of a protein to preparation of a medicament for treating infectious diseases and a feed additive. An antibacterial peptide gene pen-hepcidin is cloned from acipenser sinensis blood with an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method, and the DNA (Deoxyribose Nucleic Acid) sequence of the antibacterial peptide gene pen-hepcidin is shown as a sequence SEQ ID:1 in a sequence table. The amino acid sequence of a protein (pen-hepcidin) encoded by using the gene is shown as SEQ ID:3 in a sequence table. According to amino acid sequence analysis, a protein polypeptide which is similar to the antibacterial peptide is not found in a protein database, and belongs to a novel antibacterial peptide. The antibacterial peptide disclosed by the invention has antibacterial activity on a part of Gram-positive bacteria and Gram-negative bacteria, has a remarkable effect on drug-resistant strains, and can be used for preparing a medicament for treating infectious diseases or applied as antibacterial feed additives and the like.
Owner:HUAZHONG AGRI UNIV

Preparation method of novel estrogen receptor protein ERbetaX and application thereof

The invention discloses a preparation method of a novel estrogen receptor protein ERbetaX and an application of the ERbetaX protein, and which prepares ERbetaX protein by using molecular biological techniques; separating and purifying by adopting molecular sieve gel chromatography, ion exchange resin and silica gel chromatography; identifying and analyzing the structure through a liquid chromatography-mass spectrometry instrument, an amino acid sequence analyzer or a nuclear magnetic resonance instrument; establishing animal models of mice and rats, and carrying out toxicological experiments of ERbetaX; determining the administration dosage and the route of ERbetaX; carrying out research on the activity and pharmacokinetics of ERbetaX protein by high performance liquid chromatography (HPLC); analyzing the specificity and affinity of ligands such as estradiol (E2), Tamoxifen (TAM) and the like; studying the role and mechanism of ERbetaX in various hormone-related tumors such as breast cancer, prostate cancer, cervical cancer, ovarian cancer and colorectal cancer by biological and molecular biology experiments. The preparation method of the novel estrogen receptor protein ERbetaX hassmall toxic and side effects and low production cost, and avoids pain caused by radiotherapy and chemotherapy of patients due to surgery.
Owner:JILIN UNIV

Escherichia coli membrane protein ZraS mutant, gene for coding mutant, recombinant vector as well as preparation method and application of Escherichia coli membrane protein ZraS mutant

The invention provides an Escherichia coli bi-component regulation and control system membrane protein ZraS mutant, a gene for coding the mutant, a recombinant vector, a preparation method and an application of the Escherichia coli bi-component regulation and control system membrane protein ZraS mutant. The mutant comprises one or more of S154T, A214S, Q313R and T415A, and the mutant comprises one or more of S154T, A214S, Q313R and T415A. The preparation method of the mutants comprises the following steps: constructing the SP-ZraS bacteriophage; alternately evolving the substrate specificity of the SP-ZraS bacteriophage on the lead ions through positive screening and negative screening by adopting a bacteriophage-assisted continuous directed evolution (PACE) method, so as to obtain an evolutionary sample; performing amino acid sequencing analysis on the evolutionary sample to obtain mutation site information; and constructing an expression vector of the membrane protein ZraS mutant according to mutation site information, recording the expression vector as pZraS, and performing expression to obtain the membrane protein ZraS mutant. The response sensitivity of the mutant to metal lead ions is remarkably improved compared with that of a wild type system, the regulation and control range to lead is enlarged, and the detection limit is as low as 1 mu M; meanwhile, when the ion concentration range is 0-10 mu M, the specific and sensitive detection on the heavy metal lead ions can be realized.
Owner:GUANGZHOU INST OF ADVANCED TECH CHINESE ACAD OF SCI

Acipenser sinensis antibacterial peptide and preparation method and application thereof

The invention discloses an acipenser sinensis antibacterial peptide and a preparation method and an application thereof, and particularly discloses a novel acipenser sinensis natural antibacterial peptide pen-hepcidin, an amino acid sequence for encoding a gene and an application of a protein to preparation of a medicament for treating infectious diseases and a feed additive. An antibacterial peptide gene pen-hepcidin is cloned from acipenser sinensis blood with an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method, and the DNA (Deoxyribose Nucleic Acid) sequence of the antibacterial peptide gene pen-hepcidin is shown as a sequence SEQ ID:1 in a sequence table. The amino acid sequence of a protein (pen-hepcidin) encoded by using the gene is shown as SEQ ID:3 in a sequence table. According to amino acid sequence analysis, a protein polypeptide which is similar to the antibacterial peptide is not found in a protein database, and belongs to a novel antibacterial peptide. The antibacterial peptide disclosed by the invention has antibacterial activity on a part of Gram-positive bacteria and Gram-negative bacteria, has a remarkable effect on drug-resistant strains, and can be used for preparing a medicament for treating infectious diseases or applied as antibacterial feed additives and the like.
Owner:HUAZHONG AGRI UNIV

Amino acid sequence and polynucleotide sequence for chicken intestinal canal beta alexin and extraction method thereof

A chicken intestinal tract Beta-defensin cDNA is characterized in that the cDNA has the following sequence: TCAGACAGCCAGCTGTGCAG GAACAACCAT GGCCACTGCC GGAGGCTCTG CTTCCACATGGAGAGCTGGG CTGGGAGCTGCATGAACGGC CGCCTGCGCT GCTGCAGGTTCTCCACCAAG CAGCCCTTTT CCAACCCTAA ACATTCAGTG CTGCACACAGCAGAGCAGGA CCCTTCCCCA AGCCTTGGAG GGACGTGA. The amino acid sequence of the Beta-defensin is Ser-Asp-Ser-Gln-Leu Cys-Arg-Asn-Asn-His Gly-His-Cys-Arg- Arg Leu-Cys-Phe-His-Met Glu- Ser-Trp-Ala-Gly Ser-Cys-Met-Asn-Gly Arg-Leu-Arg-Cys-Cys Arg-Phe-Ser-Thr-Lys-Gln Pro-Phe-Ser-Asn-Pro Lys-His-Ser-Val-Leu His-Thr-Ala-Glu-Gln Asp-Pro-Ser-Pro-Ser Leu-Gly-Gly-Thr. The extraction method comprises the following steps of: (A) collecting broken mucosa cells of chicken intestinal tract; (B) breaking vesicles; (C) leaching with 5% acetic acid under stirring, centrifuging, collecting supernatant, removing sediment, subpackaging the supernatant and freeze-storing to obtain crude chicken intestinal tract Beta-defensin; (D) separating the supernatant with Sephadex G-100 gel column at low temperature, eluting with 0.2mol / L sodium acetate (constant flow pump speed 3*1), detecting with nucleic acid-protein detector, collecting the eluate with an automatic collector (1.5mL each tube), and recording with a recorder (speed 6cm / h, and range 20mV); (E) detecting the antibacterial activity of the liquid in each tube to Pasteurella with agarose diffusion method, collecting the eluate with bacteriostatic activity, and storing under vacuum freeze drying; (F) purifying the the eluate with bacteriostatic activity with Tricine-PAGE, PVDF membrane blotting the protein bands, and performing amino acid sequence analysis with Sanger partial hydrolysis method; and (G) deriving chicken intestinal tract Beta-defensin cDNA with BLAST software.
Owner:HENAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products