Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

32results about How to "Applicable detectability" patented technology

Method and device for simultaneously determining fetal nucleic acid content and aneuploidy of chromosome

The invention provides a method for determining the fetal nucleic acid content of a body liquid sample of a pregnant woman, a method for simultaneously determining the fetal nucleic acid content of the body liquid sample of the pregnant woman and variation information of fetal chromosome, a non-diagnosis method for detecting fetal nucleic acid mutation in the body liquid sample of the pregnant woman and respective devices. The method for determining the fetal nucleic acid content of the body liquid sample of the pregnant woman comprises the steps of obtaining the body liquid sample of the pregnant woman; extracting a first DNA and a second DNA from the sample, wherein the first DNA is a mixture of the DNA of the mother and the DNA of a fetus, and the second DNA is a genome DNA of the mother; sequencing the first DNA of at least one part and the second DNA of at least one part so as to obtain a first reading section and a second reading section which comprise a plurality of polymorphic sites; respectively comparing the first reading section and the second reading section with a reference sequence, and screening out a polymorphic site, which has one genotype in the second DNA and has two genotypes in the first DNA, from the multiple polymorphic sites according to an obtained comparison result; determining the fetal nucleic acid content of the sample according to the quantity of the reading sections, which support the screened polymorphic site, in the first reading section in the comparison result.
Owner:TIANJIN MEDICAL LAB BGI +2

Mobile phone short message vehicle failure remote diagnosis detection method and device

The invention relates to a mobile phone short message vehicle failure remote diagnosis detection method and device. The method comprises the following steps of: obtaining the operation state code of a vehicle from an electric control system of the vehicle to be detected; judging the vehicle operation conditions including the vehicle failure according to the operation state code; and sending the information capable of reflecting the vehicle operation conditions to a mobile phone in the form of short message. The device comprises a CPU (central processing unit) main circuit, a storage module, a GSM (global system for mobile communication) module and a communication module, wherein the CPU main circuit can decode the vehicle operation state code and control and coordinate the work of other modules; the storage module is connected with the CPU main circuit and used for storing a standard failure code library; the GSM module is in remote communication with the mobile phone terminal; and the communication module is used for communicating with the electric control system of the vehicle. According to the invention, remote vehicle diagnosis can be realized, the vehicle failure diagnosis efficiency and accuracy can be improved, and the specific failure information can be displayed visually.
Owner:北京金奔腾汽车科技有限公司

Multi-channel micro-volume sampling device

The invention discloses a multi-channel micro-volume sampling device, comprising a drive system which is connected with a control system, wherein an output end of the drive system is connected with a screw structure; a nut of the screw structure is arranged on a needle center mounting plate; the needle center mounting plate is fixed on a slide block; the slide block is matched with a linear lead rail; a plurality of needle centers are fixed on the needle center mounting plate; a needle pipe mounting plate is arranged below the needle center mounting plate; needle pipes of which the quantity is the same as that of the needle centers are arranged on the needle pipe mounting plate; the needle pipes correspond to the needle centers one by one; the needle centers extend into the needle pipe; springs are arranged at two ends of the needle pipe mounting plate; the upper ends of the springs are close to the bottom surface of the needle center mounting plate; the lower ends of the springs are connected with an unscrew plate; the unscrew plate has a through hole matched with the needle pipe; the needle pipe extends into the through hole of the unscrew plate; a sucker is arranged at the lower end of the needle pipe; and the outer diameter of the sucker is greater than the aperture of the through hole in the unscrew plate. The multi-channel micro-volume sampling device is high in sampling and loading efficiency, and suitable for a plurality of biochemical tests or sample detection, and can automatically replace the sucker; and all channels are mutually independent.
Owner:SOUTHEAST UNIV

Acetylcholinesterase biosensor and application thereof

The invention relates to an acetylcholinesterase biosensor and an application thereof, and belongs to the technical field of electrochemical detection. The biosensor is produced through the following steps: 1, preparing a MnO2-nanoflakes composite nano-material and a Pd-Pt@MnO2-nanoflakes composite nano-material from KMnO4, CTAB, PdCl2, PEG400, H2PtCl6, sodium citrate and sodium borohydride used as initial raw materials through a water bath technology; and 2, immobilizing acetylcholinesterase by using chitosan (CS), and immobilizing acetylcholinesterase (AChE) on the surface of a Pd-Pt@MnO2 modified glassy carbon electrode through adopting physical adsorption to construct the electrochemical biosensor. The biosensor adopting an electrochemistry and enzyme sensing combination technology realizes high-sensitivity detection of methyl parathion and carbofuran pesticides, has the advantages of small amount of a required sample, short detection time, high sensitivity and low cost, and is suitable for analyzing and detecting pesticide residual.
Owner:云南省产品质量监督检验研究院

Traffic load pavement vibration energy piezoelectric power generation measuring method and system thereof

The invention discloses a traffic load pavement vibration energy piezoelectric power generation measuring method and a system thereof. The traffic load pavement vibration energy piezoelectric power generation measuring system comprises a piezoelectric transduction unit, a total control module and a total measuring module which are arranged on a pavement. The piezoelectric transduction unit is used for converting pavement vibration energy into electric energy. The total control module is used for regulating speed and applying load for running vehicles and regulating electric parameters for output electric power. The total measuring module is used for measuring speed and load of a vehicle, stress and deformation of the pavement, harvested alternating-current and voltage, and transduced voltage and current. The generated electric energy can be used as a power supply to be stored and utilized. According to above condition, the traffic load pavement vibration energy piezoelectric power generation measuring system provides conditions for researching a mechanism of a pavement piezoelectric energy harvesting technology, application and popularization of the technology, and has a high academic value and social value.
Owner:杭州东南吉通网络有限公司

Gas sensitive material and preparation method and application thereof

The invention relates to a gas sensitive material capable of detecting a volatile organic compound and a preparation method of the gas sensitivity material. The preparation method of the gas sensitive material comprises the following steps: 1) adding ammonium hydroxide in a SnCl4.5H2O water solution to obtain a precipitate and a mother solution, ageing, centrifuging, washing, drying the precipitate, and roasting the product in air to obtain submicron-order SnO2; 2) placing the SnCl4.5H2O water solution in a hydrothermal reaction kettle, after naturally cooling the reaction kettle, centrifuging the precipitate, washing, and drying the precipitate to obtain nano-order SnO2; and 3) ultrasonically dispersing the submicron-order SnO2 and the nano-order SnO2 in distilled water, adding Na2PdCl4, adding ammonium hydroxide to obtain a precipitate and a mother solution, centrifuging the precipitate, washing, and drying the precipitate to obtain the gas sensitive material. The gas sensitive material has the advantages of having excellent sensitivity and accuracy, being simple and easy to control and free from toxicity in a preparation process, and being suitable for detecting the quality of air in a room and a vehicle.
Owner:WUHAN INSTITUTE OF TECHNOLOGY +1

Early warning processing method and device based on dynamic threshold, equipment and storage medium

The embodiment of the invention discloses an early warning processing method and device based on a dynamic threshold, equipment and a storage medium. According to the embodiment of the invention, theearly warning threshold value of the index data in the next index period is calculated and obtained according to the historical data of the index data in the plurality of historical year-on-year indexperiods, so that the problem that the dynamic threshold value determined by using a sliding window cannot refer to the same-period change of the plurality of historical periods in the prior art can be avoided. Furthermore, according to the embodiment of the invention, the early warning threshold value in the next index period is directly calculated; the index data newly generated in the next index period is directly pre-warned according to the calculated pre-warning threshold, so that the pre-warning processing method based on the dynamic threshold provided by the embodiment of the inventionis stronger in real-time performance, higher in efficiency and suitable for real-time effective detection and pre-warning of the index data under a large-scale instance cluster.
Owner:北京宝兰德软件股份有限公司

Detecting method and structure for microstructure binding process

The present invention relates to detection method and detection structure for micro structure bonding process result. The detection method includes first designing silicon structure pattern; preparing micro structure with silicon structure bonded with silicon substrate or glass substrate via bonding technological process, with the silicon structure having at least one end separated from the bonding surface and the bonding area being recorded; pushing the silicon structure on the no-bonding end with micro probe to make the silicon structure deform until the monocrystal silicon chip breaks from the bonding surface and recording the distance between the probe pushed point and the bonding surface, deformation and the breaking process parameters; and calculating the bonding strength based on the recorded data. The present invention completes MEMS device detection in a simple process.
Owner:PEKING UNIV

Cytoperm capable of being used as hemolytic agent and using method thereof

The invention relates to a cytoperm capable of being used as a hemolytic agent, which comprises the main components of saponin, sodium azide and paraformaldehyde. Proper amount of the components are mixed, and dissolved in phosphate buffer to prepare the cytoperm; and the cytoperm can be used as the hemolytic agent after dilution. Compared with the prior hemolytic agent and cytoperm, the cytoperm related to the invention can be directly used as the cytoperm, also can be used as the hemolytic agent after the dilution, and has double purposes. The hemolytic agent and cytoperm can be applied to a flow cytometer to detect various immunological indexes in human body blood, has obviously superior detection specificity, sensitivity and the like than imported reagents, and particularly has the advantages in pretreatment processes such as hemolysis, perm and the like on whole blood specimens of patients with leukemia, globalism and severe liver diseases.
Owner:张晖

Method for simultaneously determining nine functional components in different parts of Changshan Huyou by ultrahigh performance liquid chromatography-tandem mass spectrometry

The invention relates to a detection method, in particular to a method for simultaneously determining nine functional components in different parts of Changshan Huyou by an ultrahigh performance liquid chromatography-tandem mass spectrometry. The method comprises the following steps: dividing samples into two parts, namely peel and pulp, and sufficiently extracting by methanol-water; separating byusing an Accucore XL C18 column (150*4mm, 4.6[mu]m), performing gradient elution by using a methanol-0.15% formic acid solution as a mobile phase, performing tandem mass spectrometry detection in anelectrospray ionization source positive and negative ion switching and multi-reaction monitoring mode, and quantifying by an external standard method. Results show that the nine functional componentshave good linear relations in a relatively wide mass concentration range, and the correlation coefficients are all greater than 0.997; recycling rates in three addition levels are 83.57-112.91%, and relative standard deviations are smaller than 1.58-8.33% (n=6); four batches of Changshan Huyou samples are determined, and the nine functional components therein are determined at the same time. The method is fast, sensitive and accurate, and is suitable for qualitative and quantitative detection of the nine functional components in the Changshan Huyou.
Owner:衢州出入境检验检疫局综合技术服务中心

Separation column filler for separating PCBs (Poly Chlorinated Biphenyls) or OCPs (Organic Chlorine Pesticides) in high-fat content sample and separation method

The invention discloses a separation column filler for separating PCBs (Poly Chlorinated Biphenyls) or OCPs (Organic Chlorine Pesticides) in a high-fat content sample and a separation method. The filler is composed of 30%-35% of silica gel-florisil mixture, 50%-60% of acidic modified silica gel and 10%-15% of anhydrous sodium sulfate, by weight percentage. The separation column filler provided by the invention can be filled in a separation column for conventional column chromatography or a Seitz four-channel chromatographic separator, and used for chromatographic separation with the mixed solution of normal hexane and dichloromethane as a mobile phase. With the filler provided by the invention to separate the PCBs or the OCPs, the separation method is efficient, quick and simple in process; an obvious separation effect can be achieved under the condition of low cost; the column recovery rate of the PCBs materials is in the range from 93% to 105% and adding standard recovery to fish tissues is in the range from 74% to 100%; and the column recovery rate of the OCPs materials is in the range from 77% to 120% and adding standard recovery to fish tissues is in the range from 78% to 102%.
Owner:DALIAN MARITIME UNIVERSITY

Portable GIS partial discharge high-frequency sensor test device and test method

The invention discloses a portable GIS partial discharge high-frequency sensor test device, which comprises a modulation signal source module, VCO voltage-controlled radio-frequency oscillator module, a broadband radio frequency power amplifier module, a wireless phase synchronization signal module, a radio-frequency power indicator and a power supply module. The device is suitable for function test of all GIS partial discharge online-monitoring UHF ultra-high-frequency sensors of a substation and a GIS partial discharge online monitoring system, so that the problem that an existing GIS partial discharge online-monitoring sensor cannot carry out on-site detection and the like is thoroughly solved. The device also has functions of partial discharge online monitoring system high-frequency channel detection and UHF sensor received frequency bandwidth range determination. The device is small in size, light in weight and simple to operate, and is very suitable for substation equipment on-line monitoring sensor on-site test and verification; and the test device is powered by a high-power battery, so that the test device is long in battery duration time, does not need an external power source module and is more convenient to use on site.
Owner:贵州电网有限责任公司六盘水供电局

Method for screening chemical risk substances such as chloramphenicol antibiotics in toiletries

ActiveCN107543890ABe aware of potential hazardsImprove the concept of safe consumptionComponent separationFiltrationAntibiotic Y
The invention discloses a method for screening chemical risk substances such as chloramphenicol antibiotics in toiletries. The method comprises (1) establishing an accurate mass database and a mass spectral database of compounds to be detected, (2) pre-treating a toiletry sample through extraction, centrifugation, purification and filtration, and carrying out high-pressure liquid chromatography-quadrupole-electrostatic field orbitrap high resolution mass spectrometry analysis detection on the sample solution, and (3) comparing and analyzing the test result in the step (2) and the built accurate mass database and mass spectral database in the step (1) and carrying out chemical risk substance screening. The method has high accuracy, strong specificity and high sensitivity and can be appliedto daily detection and quality control of the toiletries.
Owner:CHINESE ACAD OF INSPECTION & QUARANTINE

Clamping method of clamp for steel wire rope

The invention belongs to the field of steel wire performance testing devices, in particular to a clamping method of a clamp for a steel wire rope. The clamping method comprises the following steps of conveying a steel wire by an external wire feeding mechanism; arranging a lower clamp on a wire feeding outlet of the external wire feeding mechanism; sending out a section of the steel wire by the external wire feeding mechanism; using a first pneumatic cylinder to push an upper clamp and enabling a first groove and a second groove to form a clamping cavity; using the external wire feeding mechanism to continue to feed the wire until the length of the steel wire reaches the required length; using the first pneumatic cylinder to push the upper clamp, and enabling the upper clamp and the lower clamp to have a clamping force therebetween; sending the steel wires drawn by a traction machine respectively to a steel wire inlet of a gathering clamp, and binding the steel wires by a steel wire binding machine. According to the clamping method of the invention, not only can non-destructive clamping of the steel wire rope be realized, but also performance testing, cutting and binding of the steel wires can be realized.
Owner:WUXI HOUFA AUTOMATIC EQUIP CO LTD

Method used for simultaneous determination of nine functional components in bitter orange through ultra-high performance liquid chromatography-tandem mass spectrometry

The invention relates to a detection method, and especially relates to a method used for simultaneous determination of nine functional components in bitter orange through ultra-high performance liquidchromatography-tandem mass spectrometry. The method comprises following steps: samples are subjected to separation so as to obtain a fruit peal part and a fruit pulp part, and methanol-water full extraction is carried out; Accucore XL C18 column (150*4mm, 4.6<mu>m) is adopted for separation, a methanol-0.15% formic acid solution is taken as a mobile phase for gradient elution, Electrospray Ionization Source positive and negative ion switching multiple- reaction monitoring mode tandem mass spectrum detection is adopted, and external standard method is adopted for quantification. It is shown inresults that the linear relationships of the nine functional components in relatively wide mass concentration ranges are excellent, the correlation coefficients are all larger than 0.997; the recovery rates of three additive amounts range from 83.57 to 112.91%; the relative standard deviations rang from 1.58 to 8.33% (n=6); four batches of citrus changshan-huyou samples are measured; and simultaneous determination of the nine functional components in the samples is carried out. The method is rapid, sensitive, and accurate, and is suitable for qualitative and quantitative determination of thenine functional components in citrus changshan-huyou.
Owner:衢州出入境检验检疫局综合技术服务中心

Mutation site combination and primer for detecting susceptible genes of type 2 diabetes as well as application of combination and primer

ActiveCN107955834AApplicable detectabilityApplicable diagnosisMicrobiological testing/measurementDNA/RNA fragmentationCDKAL1Hematopoietically expressed homeobox
The invention relates to molecular biology, in particular to a mutation site combination and a primer for detecting susceptible genes of type 2 diabetes as well as an application of the combination and the primer. The mutation site combination comprises 21 mutation sites from KCNQ1, C2CD4A, TCF7L2, SLC30A8, CDKAL1, CDKN2A / 2B, KCNJ11, PPAR2, IGF2BP2, FTO, JAZF1, GRK5, RASGRP1, HHEX, PTPRD and SSR genes. Experimental research finds that the selected mutation site combination can effectively judge whether the sample is type 2 diabetes when used for detecting mutation site genes. The best detection combination is screened out from 21 SNP sites disclosed in the prior art, and the detection accuracy rate is increased to 92% or above on the basis of cost control.
Owner:BEIJING COMPUTING CENT

Kit for qualitative detection of HPV (Human Papilloma Virus) infection in human cervical exfoliated cells

The invention relates to a kit for detecting human papilloma virus nucleic acid in human cervical exfoliated cells. The kit comprises one or more detection reagents for detecting 35 types such as HP V6, 11, 16, 18, 26, 31, 33, 35, 39, 40, 42, 43, 44, 45, 51, 52, 53, 54, 56, 58, 59, 61, 66, 68, 70, 72, 73, 81, 82, 89, 83, 67, 55, 84, 34 and the like. By using the kit, the types of 35 genes relatedto HPV (Human Papilloma Virus) can be simultaneously detected with high flux under the same reaction condition. The specificity of the detection is strong, the sensitivity is high, the minimum detection limit is 1 ng / uL, and the time is short, wherein the result can be completed within 2 hours from the sample submission to the conclusion.
Owner:GUANGDONG ASCENDAS GENOMICS TECH CO LTD

High-sensitivity current amplification circuit and chip thereof

The invention provides a high-sensitivity current amplification circuit and a chip thereof. The high-sensitivity current amplification circuit comprises a current amplification module, a high-low level output module and a voltage conversion unit; the current amplification module is used for amplifying the circuit current through a current replication circuit consisting of two groups of PMOS (positive Metal Oxide Semiconductor) tubes, and comprises an upper-stage PMOS tube group and a lower-stage PMOS tube group; the high-low level output module is a high-low level trigger composed of a PMOS transistor and an NMOS transistor; according to the current amplification circuit and the chip thereof, rapid current amplification can be achieved, two circuit modes of digital electricity and analog electricity are compatible, the working range of the amplification circuit is wide, and the amplification factor is controllable.
Owner:佛山市顺德区蚬华多媒体制品有限公司

Method for diagnosing plant gray mold by analyzing metabolome of infected plant

The invention provides a method for diagnosing plant gray mold by analyzing metabolome of an infected plant. The method disclosed in the invention diagnoses plant gray mold based on gas chromatographic-mass spectrometric (GC-MS) analysis and partial least squares discriminant analysis (PLS-DA) of the metabolome of the infected plant. The method comprises the following steps: collection of a sample; inactivation with liquid nitrogen; low temperature preservation; extraction of the metabolome; drying; silylation derivatization; GC-MS detection; establishment and detection of a PLS-DA model; etc. With the method provided by the invention, good-reproductivity results of the metabolome of plants infected by pathogens can be obtained; the established PLS-DA model can accurately identify grey mold infected samples without explicit symptoms and precisely identify samples infected by Botrytis cinerea in samples infected by other pathogens and healthy samples. The method is sensitive and accurate, provides an effective method for early diagnosis of gray mold of transplanted seedlings and colonized plants and facilitates early prevention and treatment of field gray mold.
Owner:CHINA AGRI UNIV

Kit for detecting copy number variation of PLP1 gene

The invention discloses a kit for detecting copy number variation of a PLP1 gene. The kit comprises the following primer pairs: Q-PLP1-LF: GGTCACATACACCCTGTCAAC, Q-PLP1-LR: ccagagcgagcaccttaacatcgc ,Q-PLP1-MF: CAAGGTTTCACCACTGTTCAAATC, Q-PLP1-MR: ccatctctaattatcctgggaG, Q-PLP1-RF: GGGATTTGAGGAGGGAGACC, and Q-PLP1-RR: ggacggcaaagttgtaagACgC . The kit is simple, rapid, low in pre-experiment cost and suitable for small-batch detection and verification.
Owner:CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST

Radar signal real-time detection method

The invention relates to a radar signal real-time detection method. The method is characterized by comparing an average amplitude of N sampling points before a certain moment with the amplitude of thesampling point at the moment, and if the amplitudes of the plurality of sampling points after starting of the certain moment are continuously a certain value higher than the average amplitude in a previous certain period of time, considering that a signal rising edge exists at the moment; otherwise, if the amplitudes of the plurality of continuous sampling points after a certain moment is startedare a certain value lower than the previous average amplitude, considering that a falling edge exists at the moment; and when both the falling edge and the rising edge exist, intercepting a signal part existing in data immediately. Whether a signal exists is detected in a mode of judging the rising edge and the falling edge in a time domain, and an effect of detecting the signal in real time under a passive condition can be achieved by setting reasonable parameters and thresholds.
Owner:XIAMEN UNIV

Kit for detecting copy number variation of OTC gene

The invention discloses a kit for detecting copy number variation of OTC gene. The kit comprises the following primer pairs: Q-OTC-LF, AcacagcggtggagcttgCcAT; Q-OTC-LR, ActgcagggcagggtgtagCTgc; Q--OTC-MF, CCTTAGTAATTGCTACACATATCCG; Q-OTC-MR, CcgatccagctgagggtaagTGc; Q-OTC-RF, CCTAATTCACCTTCTCTAGGTCC; and Q-OTC-RR, GAggtgagtaatctgtcagcTCgG. The method of the invention is simple, rapid, low in pre-experiment cost, and suitable for small-batch detection and verification.
Owner:广西金域医学检验实验室有限公司

Kit for detecting copy number variation of gene DNM2

The invention discloses a kit for detecting copy number variation of a gene DNM2. The kit comprises the following primer pairs of Q-DNM2-LF: GGAGCAACGGCTACAGACCGC; Q-DNM2-LR: CTCTTCCATCCCGCGGTTGGGC; Q-DNM2-MF: GGACGCCTTCAGCTCCATGCGC; Q-DNM2-MR: CGGCCCACGAAGTTCTCCAGCTGC; Q-DNM2-RF: CCAAGGTCTTCTTGGGCACGG; and Q-DNM2-RR: CCACTGGGCCAGGCTTGCCGCACG. The kit is simple, rapid, low in pre-experiment cost and suitable for small-batch detection and verification.
Owner:CHANGSHA KINGMED MEDICAL DIAGNOSTICS INST

Vital sign monitoring device and method

The invention provides a vital sign monitoring device and method. By means of an unbalanced structure of an unbalanced sagnac ring, the phase difference of two paths of light in the ring is not zero under the condition of no vibration, equivalently, the output light power of the output end of the unbalanced sagnac ring is raised in advance, the change of the phase difference can be displayed moreeasily, and dynamic response to vibration signals is facilitated. When vibration occurs, the unbalance of an unbalanced sagnac ring cavity is further increased, the phase shift of two paths of oppositely propagated optical signals is increased, after interference of a coupler, the output end outputs a signal modulated by vibration, and at the moment, the unbalanced sagnac ring is also quite sensitive to small-amplitude vibration and is suitable for vital sign detection.
Owner:武汉凯锐普医疗科技有限公司

Kit for detecting copy number variation of gene MECP2

The invention discloses a kit for detecting copy number variation of a gene MECP2. The kit comprises the following primer pairs of Q-MECP2-LF: CATCACAGCCAATGACGCCC, Q-MECP2-LR: accccgcacggccgacgtCG, Q-MECP2-MF: CAAAATGTCCCAAATAGCCCACG, Q-MECP2-MR: CAAAgcaggaactggtgagAcAg, Q-MECP2-RF: CTGCCTCTGCTCACTTGTTGAG, and Q-MECP2-RR: cctggaggtcctggtcttcAgTc. The kt is simple, rapid, low in pre-experiment cost and suitable for small-batch detection and verification.
Owner:广西金域医学检验实验室有限公司

Building surface disease detection method and system based on convolutional neural network

The invention provides a building surface disease detection method and system based on a deep learning network model. The method comprises the following steps: acquiring a building surface image as a data set; inputting the data set into a deep learning network model for learning, wherein the deep learning network model detects and fuses the multi-scale feature map of the feature extraction network in the learning process; carrying out primary iteration training on the fused feature map in the deep learning network model, carrying out secondary training according to a cosine annealing learning rate in a set range after the primary training is completed, storing parameters of the model iterated each time in the secondary training, and solving medians of all models to obtain a new model; and then identifying building surface diseases based on the trained deep learning network model. According to the method, relatively small disease features can be identified, the model AP accuracy and the target positioning and classification accuracy are greatly improved, and the identification of the disease features is more accurate.
Owner:CHONGQING UNIV

Multifunctional fixture mechanism for steel wire ropes

The invention belongs to the field of devices for detecting the performance of steel wires, and particularly relates to a multifunctional fixture mechanism for steel wire ropes. The multifunctional fixture mechanism comprises a steel wire fixture, a traction machine, a gathering fixture and a steel wire rope tying machine. The steel wire fixture comprises an upper fixture and a lower fixture, first grooves are formed in the upper fixture, second grooves are formed in the lower fixture, and clamping cavities can be formed by the first grooves and the second grooves; one end of the steel wire fixture is a steel wire input end, and the other end of the steel wire fixture is a steel wire delivering end; the gathering fixture is used for gathering a plurality of steel wires delivered by the steel wire fixture and conveying the steel wires to the steel wire rope tying machine; the traction machine is arranged between the steel wire fixture and the gathering fixture and is used for pulling the steel wires out from the steel wire fixture and conveying the steel wires to the gathering fixture; the steel wire ropes outputted from the gathering fixture can be received by the steel wire rope tying machine and can be tied up by the steel wire rope tying machine. The multifunctional fixture mechanism has the advantages that the steel wire ropes can be clamped by the multifunctional fixture mechanism without damage, the performance of the steel wires can be detected by the multifunctional fixture mechanism, and the steel wires can be cut off and tied up by the multifunctional fixture mechanism.
Owner:JIANGSU KANG BAISI MECHANICAL TECH

Method for simultaneously determining contents of a variety of components in Xinkeshu tablet

The invention belongs to the field of quality control of traditional Chinese medicine, and relates to a method for simultaneously determining the contents of a variety of components in a Xinkeshu tablet. Specifically the method comprises: 1) preparing a test substance solution by using a Xinkeshu tablet; 2) respectively preparing reference substance solutions by using 7 index components (such as sodium danshensu, protocatechualdehyde, salvianolic acid B, ursolic acid, hyperoside, costunolide and puerarin); 3) setting UPLC detection conditions; and 4) determining. With the method of the presentinvention, the contents of the 7 index components can be simultaneously determined. According to the present invention, the method is simple, rapid and accurate, can solve the defect that a variety of components cannot be simultaneously determined in the prior art, has advantages of short peal appearing time, saved determination time and improved working efficiency, is especially suitable for online quality control and detection, further has advantages of toxic solvent consumption reducing and environmental protection, and can improve the safety, the effectiveness and the controllability of preparations so as to ensure the clinical treatment effects of preparations and the health of patients.
Owner:SHANDONG WOHUA PHARMACEUTICALS CO LTD

Bearing fault detection method and device and equipment

The invention discloses a bearing fault detection method and device and equipment. The method comprises the steps that a vibration signal of a bearing is collected; signal segment division is performed on the vibration signal, and a dictionary learning sample set is obtained, wherein the dictionary learning sample set comprises signal segments obtained through division, and each signal segment contains at least one impact attenuation signal; non-correlation dictionary learning is performed on each signal segment in the dictionary learning sample set to obtain a vibration waveform dictionary, wherein the vibration waveform dictionary is composed of all the signal segments subjected to non-correlation dictionary learning; envelope demodulation processing is performed on the vibration waveform dictionary to obtain an envelope demodulation spectrum; and according to bearing fault feature frequency displayed in the envelope demodulation spectrum, a fault detection result of the bearing is determined. According to the method, non-correlation dictionary learning is utilized to process the signal segments obtained through division of the vibration signal, weak fault features can be extracted, and the method is suitable for early fault detection and diagnosis.
Owner:CRRC QINGDAO SIFANG CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More